ID: 923776701

View in Genome Browser
Species Human (GRCh38)
Location 1:236985090-236985112
Sequence TCTCACCTCCACTGAGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923776699_923776701 3 Left 923776699 1:236985064-236985086 CCTTCTGCTGGTAATTGAGGCAA No data
Right 923776701 1:236985090-236985112 TCTCACCTCCACTGAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923776701 Original CRISPR TCTCACCTCCACTGAGGAGC AGG Intergenic
No off target data available for this crispr