ID: 923778680

View in Genome Browser
Species Human (GRCh38)
Location 1:237002147-237002169
Sequence CAGCAACAGGTCAGTGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 7, 3: 26, 4: 270}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923778680_923778691 28 Left 923778680 1:237002147-237002169 CCTTCATCACTGACCTGTTGCTG 0: 1
1: 0
2: 7
3: 26
4: 270
Right 923778691 1:237002198-237002220 TGCTGCTTTTCTCTCCTCCTGGG 0: 1
1: 1
2: 5
3: 41
4: 469
923778680_923778684 -10 Left 923778680 1:237002147-237002169 CCTTCATCACTGACCTGTTGCTG 0: 1
1: 0
2: 7
3: 26
4: 270
Right 923778684 1:237002160-237002182 CCTGTTGCTGGTGCCTTCTTGGG 0: 1
1: 0
2: 3
3: 14
4: 197
923778680_923778685 2 Left 923778680 1:237002147-237002169 CCTTCATCACTGACCTGTTGCTG 0: 1
1: 0
2: 7
3: 26
4: 270
Right 923778685 1:237002172-237002194 GCCTTCTTGGGACTCTCCCAAGG 0: 1
1: 0
2: 2
3: 16
4: 157
923778680_923778690 27 Left 923778680 1:237002147-237002169 CCTTCATCACTGACCTGTTGCTG 0: 1
1: 0
2: 7
3: 26
4: 270
Right 923778690 1:237002197-237002219 TTGCTGCTTTTCTCTCCTCCTGG 0: 1
1: 1
2: 6
3: 53
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923778680 Original CRISPR CAGCAACAGGTCAGTGATGA AGG (reversed) Intergenic
901379453 1:8863253-8863275 CACAACCAGGTCAGCGATGAAGG + Exonic
904342486 1:29845796-29845818 CAGACACAGGTGAGTGACGAGGG + Intergenic
904399673 1:30247932-30247954 CAGACACAGGTGAGTGACGAGGG - Intergenic
904675746 1:32198346-32198368 CCTGAACAAGTCAGTGATGATGG - Intergenic
904910795 1:33932685-33932707 CAGCCAGAGATAAGTGATGAGGG - Intronic
905015622 1:34776697-34776719 GAGCAAAAGGTCAATGATGGAGG + Intronic
905629342 1:39510214-39510236 CGCCCACAGGTCAGTGATGTTGG - Intronic
905898825 1:41567266-41567288 CAGGAACATGGCAGTGAAGATGG - Intronic
906017194 1:42592346-42592368 CAGCACCAGGCCATTAATGAGGG - Intronic
906662924 1:47595130-47595152 CAGCAACAAGCCATTCATGAGGG - Intergenic
907642571 1:56206178-56206200 CAGCAAAACCTCAGGGATGAAGG - Intergenic
908501584 1:64748345-64748367 AAGAAACAGGACAGTAATGAAGG - Intronic
908774676 1:67628376-67628398 CTGCCACAGGACAGTGATGCTGG - Intergenic
909014855 1:70370418-70370440 CTGTAACAGGTGAGTGATAACGG - Intronic
909430392 1:75581710-75581732 CAGCACCAAGTCATTCATGAAGG - Intronic
911508507 1:98783966-98783988 CAGCCACAGTCCAGTGATGCTGG - Intergenic
911909702 1:103617174-103617196 CAGCAACAGGTCACTGTTTAAGG + Intronic
912587886 1:110783438-110783460 CAGGAAAAGGGCAGTGATGAAGG - Intergenic
914201261 1:145487457-145487479 CTCCACCAGGGCAGTGATGATGG + Intergenic
914249478 1:145909982-145910004 CAAGAACAGGTGAGTGACGAAGG + Exonic
914909657 1:151774366-151774388 TAGCAACAGGAAAGTAATGAGGG - Intronic
914915816 1:151818628-151818650 AGGCAGCAGGTCAGTGATGGTGG - Intronic
915732188 1:158061586-158061608 CAGAAACATGTGACTGATGAAGG - Intronic
916314953 1:163438724-163438746 CAGCAGCAGCTCAGTGGTGGAGG - Intergenic
916841558 1:168606874-168606896 CAGCACCAAGTCATTCATGAGGG - Intergenic
917898843 1:179520382-179520404 CTGAAAAAGATCAGTGATGAGGG - Intronic
919707424 1:200690650-200690672 AAGCAAAAGGACAGTGATGGGGG + Intergenic
920509784 1:206542269-206542291 CAGCACCAAGTCATTCATGAGGG - Intronic
920653742 1:207859005-207859027 CAGCAGGAGGCCAGTGATGCTGG + Intergenic
920923770 1:210322225-210322247 CAGCAACTGGCCAGGCATGATGG + Intergenic
922572810 1:226643921-226643943 CAGAGCCAGGTCAGTGGTGACGG + Intronic
923198912 1:231693322-231693344 CAGCAACAGATCAGTCTTGCAGG + Intronic
923205138 1:231752023-231752045 CACCAGCAGGTGAGTGCTGAGGG + Intronic
923723151 1:236484300-236484322 CACCACCAGGTCAGTGATGAAGG - Intronic
923778680 1:237002147-237002169 CAGCAACAGGTCAGTGATGAAGG - Intergenic
924235882 1:241999190-241999212 CAGCAGGAGGTCAGTTCTGATGG + Intergenic
1064906634 10:20353625-20353647 CAAAAAAAGGACAGTGATGAAGG + Intergenic
1065131036 10:22620668-22620690 CAGCACCAGATGAGTGATGCCGG - Intronic
1067828143 10:49594167-49594189 CAGCAGCCGGTCTGAGATGAGGG + Intergenic
1070159735 10:73858973-73858995 CAGCTAGGGGTCAGTGATGCAGG - Intronic
1071414268 10:85426263-85426285 CAGTAACAGGTAAGTGATGTTGG - Intergenic
1075706037 10:124501632-124501654 CTGGAACTGGACAGTGATGATGG + Intronic
1079886609 11:25998187-25998209 CAGCAACAAGTCAGGGATGTTGG - Intergenic
1080136010 11:28855772-28855794 CATCACTAGGTCAGTGATGAAGG + Intergenic
1083971509 11:66079411-66079433 CAGGAAAAGGTTAGTGAGGAGGG - Intronic
1084509803 11:69596527-69596549 CAGCCACGGGTCTGTGGTGATGG - Intergenic
1084992612 11:72942125-72942147 CAGCAGCAAGTCATTCATGAGGG - Intronic
1085601991 11:77863322-77863344 CAGCAGCGGGTCTGTGATGGCGG + Intronic
1086603627 11:88666497-88666519 GAGCAACAAGCCATTGATGAGGG + Intronic
1086791707 11:91048196-91048218 CAGCACCAAGCCAGTGATGATGG + Intergenic
1087618484 11:100516359-100516381 CAGCAACAGGTGTGAGCTGATGG - Intergenic
1087828650 11:102794728-102794750 TAGCAACATCTCACTGATGAGGG - Intronic
1088816764 11:113426581-113426603 CAGCAATGGGTCAGAGAGGATGG + Intronic
1089010230 11:115126302-115126324 CAGCCACAGATGACTGATGAGGG + Intergenic
1089212669 11:116816514-116816536 CTGGAACAGGCCAGAGATGAGGG + Intergenic
1089437419 11:118482084-118482106 CAGAATCAGGTGAGTGAGGAGGG + Exonic
1089827259 11:121289738-121289760 CAGCACCAGGACATTCATGAGGG - Intergenic
1090430328 11:126640810-126640832 CAGCAATAAGTCAGTGACGTAGG - Intronic
1090948019 11:131448776-131448798 AACCAACAGGCCAGTGATGTTGG + Intronic
1091092453 11:132784673-132784695 CAGCAACAATTCATTCATGAGGG - Intronic
1091395261 12:150478-150500 CAGTTTCAGGTCAGTGAGGAGGG + Intronic
1094493945 12:30977812-30977834 CAGCAACAGGGCTGTGAGGTGGG + Intronic
1096638658 12:52977026-52977048 CAGCAGGAGGTCAGGGGTGAGGG - Intergenic
1097055330 12:56245638-56245660 CAGCAACAGGCCAGTGGAAAAGG - Intronic
1098761165 12:74427254-74427276 CGGCAACAGGCCATTCATGAGGG - Intergenic
1098950902 12:76639633-76639655 GTGCAATAGGTTAGTGATGAAGG + Intergenic
1100067662 12:90669578-90669600 CAGCAACAAGCCATTAATGAGGG - Intergenic
1100206347 12:92354293-92354315 CACCAGCAGGCCAGTGATGGTGG + Intergenic
1100389235 12:94133080-94133102 CATCAGCAGGTAAGTAATGATGG + Intergenic
1100574927 12:95882230-95882252 CAGATAGAGGGCAGTGATGATGG + Intronic
1100869069 12:98892128-98892150 CAGCATCTGGTCAGAAATGAGGG + Intronic
1100978169 12:100143117-100143139 CAGCGACGGGTCAGCGATGGAGG - Intergenic
1101356054 12:103978512-103978534 CAGCTACATGCCAGTGATGGTGG + Intronic
1102658803 12:114506752-114506774 AGGCAACAGGTCAGTGATGGAGG - Intergenic
1103745074 12:123117044-123117066 CAGCAATAGGTAACTGATGGTGG + Intronic
1104895519 12:132161863-132161885 GAGGAACAGCTCAGTGAGGAGGG - Intergenic
1104895545 12:132161974-132161996 GAGGAACAGCTCAGTGAGGAGGG - Intergenic
1107063379 13:36185685-36185707 CATCTACAGGTCTGTGATGATGG - Intronic
1108315371 13:49231773-49231795 TAGCAACAGAACAGTGATGTTGG + Intergenic
1108503338 13:51087578-51087600 CAGCAATAGGGAAATGATGAAGG - Intergenic
1108532157 13:51337553-51337575 CAGCACCAAGACTGTGATGAAGG + Intronic
1110461402 13:75749576-75749598 CAGCAGCAGGTCAGGGAGGGAGG - Intronic
1110744143 13:79032963-79032985 CATCAACAGGTCAGGGATACGGG + Intergenic
1111263586 13:85776651-85776673 AAACAACAGGTGAGTGCTGAGGG + Intergenic
1111577755 13:90180410-90180432 CAGCAACAGGACAGCGAGGTGGG - Intergenic
1113558479 13:111257617-111257639 CAGAATCAGGTGAGTGATCACGG + Intronic
1113602271 13:111578316-111578338 CAGCAGCAGTTCAGTGCTGTGGG + Intergenic
1114383850 14:22236752-22236774 CAGCAGCAGGTCTGCGATGGTGG - Intergenic
1114523062 14:23351004-23351026 GAGCATCTGGTCAGTGGTGAAGG + Intronic
1115543563 14:34444805-34444827 CAGAAACAGGTCAGGCACGATGG + Intronic
1118311601 14:64697620-64697642 CAGCCACAGGCCTGGGATGAGGG + Intergenic
1118453517 14:65925237-65925259 CAGCGGCAGGTCTGTGATGGTGG + Intergenic
1118538030 14:66790788-66790810 CAGCCACTTGTCAGTAATGAAGG + Intronic
1119153333 14:72386037-72386059 CAGGGACAAGTCCGTGATGAGGG - Intronic
1119626721 14:76183732-76183754 CAGCAAGGGGTTAGTGAAGATGG + Intronic
1121022269 14:90587495-90587517 TAGCACCAGGTCAGGGACGATGG - Intronic
1122388345 14:101364051-101364073 CAGCAACAGGGAGGTGAGGATGG - Intergenic
1124001713 15:25765840-25765862 CAGCAGCAGGGCAGTGCTGAGGG + Intronic
1125065498 15:35480357-35480379 CATCATCAGGTCTCTGATGAAGG - Intronic
1125794879 15:42396846-42396868 CAGCACCAGGTCACTGAGGATGG + Exonic
1126403190 15:48295414-48295436 CAGCAACAGGACAGAAAGGATGG - Intronic
1126476186 15:49067854-49067876 CAGGAACTGGATAGTGATGATGG - Intergenic
1126958395 15:53961110-53961132 CAGCAAAACCTCAGGGATGAAGG - Intergenic
1129788254 15:78323238-78323260 CAGCAAGAGGTGATTGATCAGGG + Intergenic
1131423372 15:92326075-92326097 CAGATCCAGGTCAGTGATGGGGG + Intergenic
1132321601 15:100929662-100929684 GAGGAACAGGTCAGAGATGTGGG - Intronic
1136180907 16:28551262-28551284 CAGCAACATTTCAGTTATGATGG - Intergenic
1137474890 16:48799124-48799146 CAGAAAGAGGACAGGGATGAGGG + Intergenic
1140377982 16:74460528-74460550 CAGCAGTAGGCCAGTGAAGAGGG - Intronic
1141878107 16:86840245-86840267 CAGGAAAAGGTCAGAGCTGATGG + Intergenic
1142127667 16:88418244-88418266 CAGCAACAGCTCTGTGGTCAGGG + Intergenic
1145965497 17:28913865-28913887 CAGCAAGAGGTGAGTGAAGGTGG - Exonic
1147339841 17:39746797-39746819 CTGCAGCAGGTCAGTGAAGCGGG - Exonic
1147446779 17:40479585-40479607 CAGCTGCAGATCAGGGATGAAGG - Intronic
1148244577 17:46022065-46022087 CAGTAACAGGTCAGGCATGGTGG + Intronic
1148957370 17:51365008-51365030 CAGCAACAAGTCAGTGGGGCAGG - Intergenic
1150752257 17:67875692-67875714 CAGCAACATGGCAGAGAAGAAGG + Intronic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1157484687 18:48078480-48078502 CAGCATCAGGTCAGCCTTGAGGG + Intronic
1158898754 18:61941091-61941113 CAGCAACAAGCCATTCATGAAGG + Intergenic
1158902884 18:61982802-61982824 CAGCACCAAGTCATTCATGAAGG + Intergenic
1159739112 18:72142608-72142630 CAGCAGCAGGTCAGCCATGGTGG + Intergenic
1160359108 18:78255655-78255677 CAGCACCAAGCCAGTCATGAGGG + Intergenic
1160758852 19:772339-772361 GAGCAACAGCTGTGTGATGAGGG - Intergenic
1162856268 19:13470757-13470779 CAGCAAGAGATCAGAGAGGAGGG + Intronic
1166644697 19:44522952-44522974 CAGCAACAGGTCTCTTATGGAGG + Intronic
1166974802 19:46599803-46599825 CAGCACCAAGTCATTCATGAGGG + Intronic
1167166912 19:47804702-47804724 CAGTACCTGATCAGTGATGAAGG - Intronic
1167174925 19:47859062-47859084 CAGTACCTGATCAGTGATGAGGG + Intergenic
1167694808 19:51009209-51009231 CAGCCAGCGGTCACTGATGAGGG + Exonic
926244421 2:11112768-11112790 CAGCAAAAGTACAGTGAGGAAGG + Intergenic
926610002 2:14937105-14937127 CAGCAACAGGGCAGGGAAGTAGG + Intergenic
927869718 2:26615790-26615812 CAGAAAAAGCTCAGTGATGTAGG - Intronic
928676631 2:33657561-33657583 CAGCAGCGGGTCTGTGATGGCGG - Intergenic
929084698 2:38156984-38157006 CATTAACAGGTCAGTTCTGAGGG + Intergenic
930489976 2:52057452-52057474 CGGCACCAGGTCATTCATGAGGG - Intergenic
933293431 2:80463099-80463121 CAGAAAAAGGTCAGAGATGGAGG - Intronic
933500205 2:83101784-83101806 CAGCAGCAGGTCTGCGATGGTGG - Intergenic
934591921 2:95561354-95561376 CTCCCACAGGACAGTGATGAGGG - Intergenic
934780851 2:96968715-96968737 CAAGAGCAGGACAGTGATGAGGG - Intronic
936548488 2:113413726-113413748 CAGCAAGAGGTCAGAAATGGTGG - Intergenic
937594971 2:123661588-123661610 CAGCAGCAGGTCTGTGACGGCGG - Intergenic
937901653 2:127024677-127024699 CAGCAGCTGGTCAATAATGAAGG + Intergenic
938170640 2:129072649-129072671 CAGCAACAGGCCAAAGAAGATGG + Intergenic
938652974 2:133402583-133402605 CAGCACCAAGCCATTGATGAGGG - Intronic
939294607 2:140244080-140244102 CAGAGGCAGGTCAGTGAGGAAGG - Intronic
939998913 2:148947817-148947839 CAGCATGATGTCAGTGATGATGG - Intronic
940941060 2:159561193-159561215 CAGCACCAGGCCATTCATGAGGG - Intronic
941063782 2:160878051-160878073 CAGCAACAGTTAAGTCTTGAGGG - Intergenic
941633351 2:167908430-167908452 CAGCAACAGGCCAGGCATGGTGG + Intergenic
943049597 2:182899162-182899184 AAGAAATAGGTCAGGGATGATGG - Intergenic
943727454 2:191266955-191266977 CAGGCACAGGCCAGTGATTAAGG - Intronic
944208293 2:197180201-197180223 CAGCAAATATTCAGTGATGAAGG - Intronic
944758664 2:202790593-202790615 CAGCAACAGGTAACTGGGGACGG - Intronic
944931831 2:204527950-204527972 CAGCACCAAGTCATTCATGAAGG + Intergenic
947371491 2:229451169-229451191 CAGCAACAGGCCAGGCGTGATGG + Intronic
948175288 2:235938291-235938313 CAGCAGCAGGTCGGTGGTCAAGG + Intronic
948230871 2:236348538-236348560 CAGTAGCAGGTAAGTGAGGAGGG + Intronic
948231147 2:236350611-236350633 CAGCAACTGGTAAGTGCTGGAGG + Intronic
1169754023 20:9024279-9024301 CAGCAAGAGGCCAGTGTTGGAGG - Intergenic
1170589420 20:17760597-17760619 CACCCTCAGGTCAGTGAGGATGG + Intergenic
1171102482 20:22398521-22398543 CAGCAATAGGTAAGGAATGAGGG - Intergenic
1171465226 20:25323256-25323278 CAGCACCAGCTCAGTCATGTAGG + Intronic
1173336328 20:42115062-42115084 CAGCAACAGATCAGCAATCAGGG - Intronic
1174115324 20:48222998-48223020 AAGCAGGAGGTCAGTGAGGAGGG + Intergenic
1174946428 20:54991280-54991302 CAGAAAGAGGGCAGAGATGAAGG - Intergenic
1176409338 21:6439493-6439515 CTGCAACATGTCAGTTTTGAGGG - Intergenic
1177302292 21:19263701-19263723 CAGCATCAAGTCATTCATGAGGG - Intergenic
1178838904 21:36122707-36122729 AAGCAACAGGACAGCTATGAAGG + Intergenic
1179027477 21:37691622-37691644 CAGCCACTGCTCAGTGATTACGG + Intronic
1179684831 21:43047815-43047837 CTGCAACATGTCAGTTTTGAGGG - Intergenic
1181163646 22:20972056-20972078 CAGCACCTGGTTAGTGATGAAGG + Intronic
1181386159 22:22547322-22547344 CAGCCACAGGCCAGGGATGGAGG + Intergenic
1182328934 22:29536575-29536597 CAGCGCCTGGTCAGTGGTGAAGG + Intronic
1184332598 22:43835573-43835595 CACCAACAGGTCAATAATCATGG + Intronic
1184426752 22:44413366-44413388 CAGCAGCAGATCAGTCGTGACGG - Intergenic
1184866606 22:47205075-47205097 GAGCCACAGGTGAGGGATGAGGG + Intergenic
1184947417 22:47813443-47813465 CAGCACGAGGTGAGTGATGGAGG + Intergenic
1185157837 22:49204984-49205006 CAGCCACAGGGCAGTGCAGAAGG - Intergenic
949219970 3:1620272-1620294 AAAAAACAGGTCAGTGATGGGGG + Intergenic
952105762 3:30067695-30067717 CAACAACAGGTCATTGTTGAAGG - Intergenic
952638254 3:35557734-35557756 CAGCACCAGGTCAGTTCTCATGG + Intergenic
952822548 3:37497953-37497975 AAGCAACAGGACAGTGTAGAGGG + Intronic
953458238 3:43061037-43061059 TAGGAAGAGGTCAGTGTTGATGG - Intergenic
954476381 3:50750208-50750230 CAGGGCCAGGTCAGGGATGAGGG - Intronic
956874988 3:73453886-73453908 CATCAACAGGTCATTGCAGAGGG + Intronic
960006987 3:112790757-112790779 CAGCGTCAGGTCTGTGATGGCGG + Intronic
960958942 3:123055550-123055572 GAGCAGCAAGTCGGTGATGAGGG + Intergenic
962008623 3:131372084-131372106 CACCAACAGCTCCCTGATGAAGG + Intergenic
962540899 3:136380730-136380752 CAGGAACAGGCCAGGCATGATGG + Intronic
963381524 3:144536584-144536606 CTGCAACTTGTCAGTGATCAAGG - Intergenic
963381530 3:144536670-144536692 CCGCAACTTGTCAGTGATCAAGG - Intergenic
964236773 3:154540167-154540189 AAGGAACAAGTCAGTGATGATGG - Intergenic
964886120 3:161485004-161485026 CTACCACAGGTCAGTGACGATGG + Intergenic
965849280 3:173003621-173003643 GAGCAAAGGGTCATTGATGATGG + Intronic
966428576 3:179807643-179807665 CAGCAACAGGCCAAGGATGAAGG - Intronic
967020969 3:185522291-185522313 CAACAACACTTCAGTAATGAGGG - Intronic
967308274 3:188081118-188081140 TAGCAGCAGGTCAGTGTTGCTGG + Intergenic
968770843 4:2505639-2505661 CACCAACAGGTCTAAGATGATGG - Intronic
970011958 4:11469063-11469085 CAGCAACAGGTGCATGAGGAAGG + Intergenic
970707675 4:18823768-18823790 CAGCATCAAGTCATTCATGAGGG - Intergenic
974605943 4:64149875-64149897 CAGCAACAGATGAGTGAGAATGG - Intergenic
975333552 4:73148881-73148903 CTGGAAGAGGTCAATGATGAAGG - Exonic
978536502 4:109768722-109768744 CAGCTACAGGGCACTGAGGAAGG - Intronic
978736827 4:112093245-112093267 CAGCATCAAGTCATTCATGAGGG + Intergenic
980273190 4:130614336-130614358 CAGCAACATGTGAGTGAAGAAGG - Intergenic
981067987 4:140505674-140505696 CAGCAACAGGTGAGTGATAGAGG + Intergenic
982661423 4:158211479-158211501 GTGCAACAGGTCAGAGATGCAGG - Exonic
982830403 4:160053022-160053044 CAGCAACAAGTCATTTATGAAGG + Intergenic
984905755 4:184624485-184624507 CAGAAACAGGTCAGTGATGGAGG - Intergenic
984905759 4:184624515-184624537 CAGAAACAGGTCAGTGATGGAGG - Intergenic
984905763 4:184624545-184624567 CAGAAACAGGTCAGTGATGGAGG - Intergenic
984905767 4:184624575-184624597 CAGAAACAGGTCAGTGATGGAGG - Intergenic
984905771 4:184624605-184624627 CAGAAACAGGTCAGTGATGGAGG - Intergenic
984905775 4:184624635-184624657 CAGAAACAGGTCAGTGATGGAGG - Intergenic
984905779 4:184624665-184624687 CAGAAACAGGTCAATGATGGAGG - Intergenic
984905783 4:184624695-184624717 CAGAAACAGGTCAATGATGGAGG - Intergenic
984905787 4:184624725-184624747 CAGAAACAGGTAAGTGATGGAGG - Intergenic
984951312 4:185009802-185009824 CGGCAAGAGGTGGGTGATGATGG - Intergenic
985228121 4:187784557-187784579 CATCAGCAGGCCAGTGATAATGG + Intergenic
985788880 5:1914865-1914887 CAGCAATAGGTGAGTGAAGCAGG + Intergenic
986153792 5:5153061-5153083 CAGCAACAGCTCCATGATTAAGG - Intronic
986228581 5:5840680-5840702 CAGCAACATTTCAGTCAAGAAGG - Intergenic
986418337 5:7550711-7550733 CTGCCTCAGGTAAGTGATGAGGG - Intronic
988257560 5:28841073-28841095 CAGCCACAAGTCAGTTATGATGG + Intergenic
988882285 5:35516615-35516637 CAGCAGGAGGTGAGTGGTGATGG + Intergenic
991262525 5:64682799-64682821 CAGCAACAGGTCTGTGGAGGTGG - Intergenic
991554198 5:67876910-67876932 CAGCATCAAGTCATTCATGAGGG - Intergenic
991562056 5:67964301-67964323 CAGCCCCAGGTGAGGGATGAGGG - Intergenic
991933948 5:71783523-71783545 GAGCAACAGATCAGTGAAAAGGG - Intergenic
993174172 5:84460898-84460920 CAGCATCAAGTCATTCATGAGGG + Intergenic
995185747 5:109268100-109268122 CAGCACCAGGTCAGATATTATGG + Intergenic
995327958 5:110913028-110913050 CAGCAACAAGCCATTCATGAGGG + Intergenic
995749952 5:115443002-115443024 CAGCAACAGAACAAAGATGACGG + Intergenic
999891609 5:155983976-155983998 CTGGAACAAGTCAGTGAAGAAGG - Intronic
1002015129 5:176315354-176315376 CAGCACCAAGACAGTTATGAAGG + Intronic
1002579537 5:180199358-180199380 CAGGATCCGGTCAGTGATGAAGG - Intronic
1002937501 6:1686114-1686136 CAGCAAAGGGTCTGTAATGAGGG - Intronic
1003419061 6:5939413-5939435 CTGGAGCAGGTCAGTGATGCTGG + Intergenic
1003439373 6:6124814-6124836 CAGCACCAAGTCATTTATGAGGG - Intergenic
1005111670 6:22288562-22288584 CAGCAACCCTTCAGTGGTGAGGG + Intronic
1005789664 6:29284863-29284885 CAGCATCAGGTAAATGTTGAAGG + Intergenic
1006226902 6:32547115-32547137 CGGCACCAAGCCAGTGATGAAGG - Intergenic
1006537002 6:34707593-34707615 CATCAACAGGTCACTGGTCAAGG - Intergenic
1006994509 6:38245732-38245754 GTGGAACAGGTAAGTGATGATGG + Intronic
1007302763 6:40880458-40880480 AAGCAAGAGGTCTGTGTTGATGG + Intergenic
1007964408 6:45990325-45990347 CAGCAATAGGTCAGTGAGTTAGG + Intronic
1007984485 6:46194106-46194128 TAGCAACTTCTCAGTGATGAAGG - Intergenic
1009464465 6:63952903-63952925 CTGTAACAGGTGAGTGATAATGG - Intronic
1009943455 6:70316717-70316739 TAGCAAGAGCTCAGGGATGAGGG + Intergenic
1011496823 6:87944799-87944821 CAGCATGAGGTCAGTGCTGGTGG - Intergenic
1013070432 6:106724160-106724182 CAGAAACAGGCCAGAGATGATGG + Intergenic
1014271887 6:119345819-119345841 CAGGAACAGGTCAGGCATGGTGG + Intronic
1015925579 6:138307348-138307370 CGGGAACAAGTCAGAGATGAAGG + Exonic
1016867153 6:148778729-148778751 CAACACAATGTCAGTGATGATGG - Intronic
1016883902 6:148940197-148940219 CAGTAACAGGTCAGGCATGGTGG + Intronic
1019221808 6:170479011-170479033 CAGCACCAGCTAAGTGATGATGG - Intergenic
1019297505 7:285911-285933 CAGCAAGAGGTGAGAGGTGAGGG + Intergenic
1019894281 7:3971670-3971692 CAGCAGCAGGTCCCTGATTACGG + Intronic
1020480772 7:8657546-8657568 CAGCATCAAATCAGAGATGAGGG + Intronic
1020794346 7:12662559-12662581 CTGTAACAGGTGAGTGATAATGG - Intergenic
1022127481 7:27372382-27372404 CAGCACCAGGCCATTCATGAAGG + Intergenic
1023039708 7:36161412-36161434 CAGCATTCGGTCAGGGATGAAGG + Intronic
1023282932 7:38590365-38590387 CAGCAGCGGGTCTGTGATGGCGG + Intronic
1026213082 7:68324129-68324151 CAGCAGCAGGTCTGCGATGGTGG - Intergenic
1026986368 7:74557479-74557501 CATCAACATGTCGGTGCTGAAGG + Intronic
1028993388 7:97074810-97074832 CAGCAGCAGGTCTGTGACGGCGG - Intergenic
1029210889 7:98907710-98907732 CTGCAACAAGTCAGAGAGGAAGG - Intronic
1031742826 7:125455925-125455947 CAGCAGCGGGTCTGTGATGGCGG + Intergenic
1034148747 7:148896566-148896588 GAGCAAGAGGACAGTGAGGAGGG + Intergenic
1034390378 7:150782404-150782426 CAGGAACAGGCATGTGATGAGGG + Intergenic
1036503801 8:9337060-9337082 GAGCAAAGTGTCAGTGATGAAGG - Intergenic
1042785187 8:72537760-72537782 CAGCGACAGGTCATTGGCGAAGG + Exonic
1043477130 8:80615958-80615980 GAGTCACAGGTCAGAGATGAGGG - Intergenic
1045282663 8:100762710-100762732 CATCAATATGTCAGTGTTGACGG - Intergenic
1045777793 8:105826340-105826362 CAACAAGATGTCAGTGTTGAGGG - Intergenic
1046599506 8:116299809-116299831 GTGCTACAGGACAGTGATGAGGG + Intergenic
1047655738 8:126974976-126974998 CTGCAGCAGGTCAATGAGGAAGG - Intergenic
1048270265 8:133022653-133022675 GATCAACAGGTTTGTGATGAGGG - Intronic
1048378118 8:133840205-133840227 CAGTAAGAGGCCAATGATGAGGG - Intergenic
1049904507 9:203447-203469 CAGCAAGAGGTCAGAAATGGTGG + Intergenic
1053727079 9:41015021-41015043 CAGCAAGAGGTCAGAAATGGTGG + Intergenic
1056136423 9:83633416-83633438 CACCTGCAGGGCAGTGATGAGGG - Intronic
1057225973 9:93293299-93293321 CAGGGACAGGGGAGTGATGAAGG + Intronic
1057699186 9:97350371-97350393 GAGGAACAGGACAGTGATGGGGG - Intronic
1057738360 9:97688764-97688786 CAGCAACAAGCCAATCATGATGG + Intronic
1058138493 9:101334071-101334093 GAGCAAAAGCTGAGTGATGATGG - Intergenic
1062507517 9:136885829-136885851 CTGCAACCGGACAGTGGTGACGG - Intronic
1190032170 X:46984505-46984527 GACGAACAGGTCAGTCATGAGGG - Intronic
1190120937 X:47658841-47658863 CTGCAGCACGTCACTGATGAAGG + Exonic
1191014055 X:55791020-55791042 CTGTAACAGGTGAGTGATAACGG + Intergenic
1191842955 X:65525975-65525997 CAGCACCAAGTCATTCATGAGGG - Intronic
1192602885 X:72483322-72483344 CAGCACCAAGTCATTCATGAAGG - Intronic
1197161509 X:123327880-123327902 AAGAATCAGGTCAGTGATGTTGG + Intronic
1198139424 X:133787936-133787958 CAATAATAGGTCAGTGATTAAGG + Intronic
1199079120 X:143556720-143556742 CAACAACACATGAGTGATGATGG + Intergenic
1199677171 X:150198510-150198532 CCGCACCAGCTCATTGATGATGG + Intergenic
1200088550 X:153623757-153623779 CAGCAGCAGGTGGGTGCTGACGG - Intergenic
1200115745 X:153769012-153769034 CAGCAGCAGGTCTGGGCTGATGG - Exonic
1201582031 Y:15519518-15519540 CAGCAGCAGGTCTGCGATGGTGG + Intergenic
1202274069 Y:23097697-23097719 CAGCAACAGCTGACTGATGCAGG + Intergenic
1202291957 Y:23322980-23323002 CAGCAACAGCTGACTGATGCAGG - Intergenic
1202427065 Y:24731442-24731464 CAGCAACAGCTGACTGATGCAGG + Intergenic
1202443726 Y:24938652-24938674 CAGCAACAGCTGACTGATGCAGG - Intergenic