ID: 923779810

View in Genome Browser
Species Human (GRCh38)
Location 1:237012093-237012115
Sequence CCGAACCAGAGGAAGTACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923779810_923779820 16 Left 923779810 1:237012093-237012115 CCATTGTACTTCCTCTGGTTCGG No data
Right 923779820 1:237012132-237012154 CGGATGCTGCACTTTGCCGGGGG No data
923779810_923779823 23 Left 923779810 1:237012093-237012115 CCATTGTACTTCCTCTGGTTCGG No data
Right 923779823 1:237012139-237012161 TGCACTTTGCCGGGGGGACTGGG No data
923779810_923779818 14 Left 923779810 1:237012093-237012115 CCATTGTACTTCCTCTGGTTCGG No data
Right 923779818 1:237012130-237012152 CTCGGATGCTGCACTTTGCCGGG No data
923779810_923779821 17 Left 923779810 1:237012093-237012115 CCATTGTACTTCCTCTGGTTCGG No data
Right 923779821 1:237012133-237012155 GGATGCTGCACTTTGCCGGGGGG No data
923779810_923779822 22 Left 923779810 1:237012093-237012115 CCATTGTACTTCCTCTGGTTCGG No data
Right 923779822 1:237012138-237012160 CTGCACTTTGCCGGGGGGACTGG No data
923779810_923779819 15 Left 923779810 1:237012093-237012115 CCATTGTACTTCCTCTGGTTCGG No data
Right 923779819 1:237012131-237012153 TCGGATGCTGCACTTTGCCGGGG No data
923779810_923779817 13 Left 923779810 1:237012093-237012115 CCATTGTACTTCCTCTGGTTCGG No data
Right 923779817 1:237012129-237012151 CCTCGGATGCTGCACTTTGCCGG No data
923779810_923779814 -4 Left 923779810 1:237012093-237012115 CCATTGTACTTCCTCTGGTTCGG No data
Right 923779814 1:237012112-237012134 TCGGAGACTCTGGTGTCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923779810 Original CRISPR CCGAACCAGAGGAAGTACAA TGG (reversed) Intergenic
No off target data available for this crispr