ID: 923779819

View in Genome Browser
Species Human (GRCh38)
Location 1:237012131-237012153
Sequence TCGGATGCTGCACTTTGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923779810_923779819 15 Left 923779810 1:237012093-237012115 CCATTGTACTTCCTCTGGTTCGG No data
Right 923779819 1:237012131-237012153 TCGGATGCTGCACTTTGCCGGGG No data
923779808_923779819 24 Left 923779808 1:237012084-237012106 CCTTGATGGCCATTGTACTTCCT No data
Right 923779819 1:237012131-237012153 TCGGATGCTGCACTTTGCCGGGG No data
923779813_923779819 4 Left 923779813 1:237012104-237012126 CCTCTGGTTCGGAGACTCTGGTG No data
Right 923779819 1:237012131-237012153 TCGGATGCTGCACTTTGCCGGGG No data
923779807_923779819 29 Left 923779807 1:237012079-237012101 CCTGTCCTTGATGGCCATTGTAC No data
Right 923779819 1:237012131-237012153 TCGGATGCTGCACTTTGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923779819 Original CRISPR TCGGATGCTGCACTTTGCCG GGG Intergenic
No off target data available for this crispr