ID: 923781798

View in Genome Browser
Species Human (GRCh38)
Location 1:237031548-237031570
Sequence AAGCCTCTAAATGGTTGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923781798_923781801 -6 Left 923781798 1:237031548-237031570 CCTTTACAACCATTTAGAGGCTT No data
Right 923781801 1:237031565-237031587 AGGCTTGTTTTTTTGCCTGGAGG No data
923781798_923781800 -9 Left 923781798 1:237031548-237031570 CCTTTACAACCATTTAGAGGCTT No data
Right 923781800 1:237031562-237031584 TAGAGGCTTGTTTTTTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923781798 Original CRISPR AAGCCTCTAAATGGTTGTAA AGG (reversed) Intergenic
No off target data available for this crispr