ID: 923783231

View in Genome Browser
Species Human (GRCh38)
Location 1:237043300-237043322
Sequence TGCGCGCGCGCGGGTGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 275}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923783224_923783231 27 Left 923783224 1:237043250-237043272 CCGCTTGCAAAGCGTGGAAGGCA 0: 1
1: 0
2: 0
3: 7
4: 105
Right 923783231 1:237043300-237043322 TGCGCGCGCGCGGGTGGTGGTGG 0: 1
1: 0
2: 2
3: 33
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923783231 Original CRISPR TGCGCGCGCGCGGGTGGTGG TGG Intronic
900162826 1:1232417-1232439 CGCGCGGGCGCGGGGGGAGGCGG - Exonic
900516561 1:3084963-3084985 TGCAGGCGGGCGGGTGCTGGGGG + Intronic
900629239 1:3624991-3625013 GGGGCGCGGCCGGGTGGTGGCGG + Exonic
901499680 1:9644074-9644096 TGGGCATGCGTGGGTGGTGGTGG + Intergenic
902465196 1:16613226-16613248 TGCGCGAGCGCGGGGGCGGGTGG - Intronic
902476738 1:16692466-16692488 GGCGGGCGGGCGGGCGGTGGCGG + Intergenic
903155607 1:21440438-21440460 TGCGCGAGCGCGGGGGCGGGTGG + Intronic
904244969 1:29181448-29181470 TGCGCGGGTGGGGGTGGTGGAGG - Intronic
904244972 1:29181454-29181476 TGCGCCTGCGCGGGTGGGGGTGG - Intronic
904494902 1:30881003-30881025 TGCGTGCGCGCGTGTCTTGGGGG - Intronic
904642051 1:31938341-31938363 TGCGCGCGCAGCGGTGGTGGTGG - Exonic
907526483 1:55056872-55056894 CGCGCGCGCGTTGGGGGTGGGGG + Intronic
909938399 1:81581854-81581876 TGCGCGCATGTGTGTGGTGGTGG - Intronic
912435183 1:109656589-109656611 TGCGTGCGCCGGGGTGGGGGGGG + Intronic
912765658 1:112407926-112407948 TGCGTGAGCCCGGGTGGTGGAGG - Intronic
914869119 1:151458810-151458832 TGCGCGCGCGCGCGCCGCGGCGG + Intronic
915393286 1:155562912-155562934 GGCGCACGCGCGAGGGGTGGAGG - Intergenic
916651665 1:166839606-166839628 TGAGTGCGCGCGGGCGGGGGCGG + Intronic
918048345 1:180954406-180954428 CGCGTGCGCGCGTGTGCTGGGGG - Intergenic
919748626 1:201023474-201023496 GGCGCGGGCGCGGCTGGCGGAGG + Exonic
921746227 1:218743347-218743369 TAGCCGGGCGCGGGTGGTGGTGG + Intergenic
922165152 1:223109148-223109170 TGCGCGCGTGTGTGTGTTGGAGG + Intergenic
922958557 1:229625814-229625836 CGCGCGCGCGCGGGCGGGCGGGG - Intronic
923782966 1:237042322-237042344 CGCTCGGGCGCGGGTGGTCGAGG - Exonic
923783231 1:237043300-237043322 TGCGCGCGCGCGGGTGGTGGTGG + Intronic
924289510 1:242523995-242524017 TGAGCGCGCGCGGGGCGCGGGGG - Intronic
1062794895 10:337347-337369 TGCGCGCGTGTGTGTTGTGGAGG + Intronic
1065520574 10:26567294-26567316 GGCGCGGGCGCGGGCGGCGGCGG - Exonic
1065637273 10:27744688-27744710 TGCGCGCGCGCGTGTGTTAGTGG - Intronic
1069976285 10:72215990-72216012 TGCGCGCGCCCGTGCCGTGGTGG - Exonic
1070112113 10:73496029-73496051 TGCGCGTGCGGGGGTGGGGGCGG + Intergenic
1070150251 10:73800874-73800896 TGTGCGTGCGCGGGGGGCGGAGG + Intronic
1072021837 10:91410285-91410307 GGCGCGGGCGCGGGCGGGGGCGG + Exonic
1073097233 10:100987275-100987297 TGCGCAGGCGCGGGTCGGGGTGG - Intronic
1073139822 10:101239682-101239704 TGCGCGCGCGCGTGTGTAGAAGG - Intergenic
1073146743 10:101286136-101286158 TGCCCGCCCGCTGGGGGTGGGGG + Intergenic
1074452030 10:113567283-113567305 TCAGCGCGCACAGGTGGTGGTGG + Intronic
1075039487 10:119096558-119096580 TGCTTGAGCGCGGGAGGTGGAGG + Intergenic
1076120588 10:127934010-127934032 TGTGTGTGCGCGGGGGGTGGGGG - Intronic
1076907926 10:133372721-133372743 TGCGGGGTGGCGGGTGGTGGGGG + Intronic
1077290591 11:1788948-1788970 TGCTGGAGCCCGGGTGGTGGAGG + Intergenic
1077505717 11:2929224-2929246 GGGGCGCGCGCGGGGGCTGGCGG + Exonic
1077545041 11:3165473-3165495 GGAGCGCGCGCGGGGGGTTGGGG - Intronic
1081981428 11:47269616-47269638 CGGGCGCGCGCGGGGAGTGGGGG - Intronic
1083227516 11:61294426-61294448 TGCGTGTGCGCGCGTGGGGGTGG - Intronic
1083890295 11:65592507-65592529 TGCGCGCTCGCGGCGGGTGCGGG + Exonic
1084146154 11:67266432-67266454 CGCGGGCGCGCGGGCGGCGGCGG + Exonic
1084319196 11:68364038-68364060 TGCGCGGGCGTGGGTGGGGTGGG + Intronic
1088348399 11:108856854-108856876 TTCTCACGCGGGGGTGGTGGGGG - Intronic
1088566744 11:111180601-111180623 TGCGCGCACGCGTGTGGTGGGGG - Intergenic
1090699075 11:129278918-129278940 GGCGCGGGCGCGGGAGGCGGTGG + Intronic
1090838292 11:130469301-130469323 TGCTCGCGCACATGTGGTGGGGG + Exonic
1092164478 12:6334579-6334601 TGCTTGAGCGTGGGTGGTGGAGG - Intronic
1092843341 12:12562953-12562975 CGCGCGGGCGCGGGAGGAGGAGG - Intergenic
1093547841 12:20369210-20369232 TGCGCGCGCGCGCGTGGGTCGGG + Intergenic
1093547843 12:20369214-20369236 CGCGCGCGCGTGGGTCGGGGCGG + Intergenic
1094040989 12:26122158-26122180 TGCGGCCGTGCGGGTGCTGGGGG + Exonic
1094218512 12:27970350-27970372 GGCGGGCGCGCGGGGGGCGGGGG + Intronic
1095261664 12:40105630-40105652 AGCGCGGGCGCGGGCGGCGGCGG - Exonic
1096713366 12:53474973-53474995 GGCGAGCGAGGGGGTGGTGGTGG - Intronic
1096994615 12:55830809-55830831 CGCGCGCGTGCGCGCGGTGGGGG - Intronic
1098671976 12:73242187-73242209 TGCGCGCGCGTGTGTGGTGTTGG + Intergenic
1101504147 12:105330908-105330930 CGCGCCCGCGCTGGTGGCGGTGG - Exonic
1101641258 12:106586980-106587002 TGCGCGCGCGCGGGCGAACGGGG + Intronic
1103325363 12:120116666-120116688 TGCGCGCGGGCGGGCGGGGTCGG + Exonic
1103488198 12:121296743-121296765 GGCGGGCGCGCGGGGGGCGGGGG + Intronic
1103528870 12:121586104-121586126 TGCCTGAGCGCGGGAGGTGGAGG - Intergenic
1105368525 13:19782603-19782625 GGCGCGGGCGCGGGCGGTGCCGG + Exonic
1105698605 13:22915846-22915868 GGCGCGGGTGCGGGTGGTGATGG - Intergenic
1106735673 13:32586295-32586317 TGCGCGCGCGCGGACGGGGCGGG + Intergenic
1107467547 13:40664825-40664847 GGGGCGGGCGCGGGCGGTGGCGG - Intronic
1107549035 13:41457951-41457973 GGCGCGCGCGGAGCTGGTGGTGG - Intronic
1108363708 13:49690488-49690510 TGCGTGCGCGTGTGTGGTGGGGG + Intronic
1109618724 13:64872171-64872193 TGCACGGGCACTGGTGGTGGTGG - Intergenic
1112505078 13:99970573-99970595 TGCGCGGGCGCCGGCGGCGGCGG + Exonic
1112560249 13:100506370-100506392 TTCGCGGGCGGGGGTGGGGGCGG + Intronic
1113517383 13:110914366-110914388 CGCGCGCGCGCGGATGGTGCGGG - Intronic
1113655608 13:112066664-112066686 TGAGCGCGCGCGCGCGGCGGCGG - Intergenic
1113656066 13:112068354-112068376 GGTGCGCGTGCGGGTGGTGCGGG - Exonic
1113660862 13:112105575-112105597 TGCGCGGGTGCGGGAGGCGGAGG + Intergenic
1114051151 14:18920580-18920602 TGCGGTGGCGGGGGTGGTGGAGG + Intergenic
1114111411 14:19481345-19481367 TGCGGTGGCGGGGGTGGTGGAGG - Intergenic
1115028581 14:28768224-28768246 TGCTGGCGCGGGGGTGGTGCAGG - Exonic
1118925495 14:70187642-70187664 CGCGCGCGCGTGTGTGTTGGGGG + Intronic
1121412443 14:93757304-93757326 TGAGCTCGAGCTGGTGGTGGTGG - Intronic
1122214503 14:100193949-100193971 TGCGGGGGCGGGGGTGGGGGTGG + Intergenic
1122736602 14:103847271-103847293 TGAGGGCGGGCGGGAGGTGGCGG - Intronic
1122884212 14:104703408-104703430 TGCGCGCGCGCAGGTCCTCGGGG - Exonic
1122993303 14:105248994-105249016 GGCGCGGGCGCGGGCGGCGGCGG - Exonic
1123114298 14:105886915-105886937 GGCCCGTGCGCAGGTGGTGGTGG + Intergenic
1127845987 15:62871383-62871405 TGCAGGCGGGCAGGTGGTGGGGG + Intergenic
1128791137 15:70434706-70434728 CGCGCGCGCGCGGGTGGAGCGGG - Intergenic
1128791139 15:70434712-70434734 TGCGCGCGCGCGCGCGCGGGTGG - Intergenic
1132055498 15:98648312-98648334 TGTGTGCGCGCGGGAGGCGGTGG + Intergenic
1132774680 16:1586452-1586474 TGCCAGTGCGGGGGTGGTGGGGG + Intronic
1133212662 16:4272092-4272114 TGCTCGCGTGTGGGTGTTGGGGG - Intronic
1134149830 16:11797051-11797073 GGCGCGCGCGGGGGGGGCGGGGG + Intronic
1134335243 16:13293226-13293248 TGCGCGCGTGCGTGTGTTGTGGG - Intergenic
1134441507 16:14302051-14302073 CGCGCCCGCCCGGGTGGGGGTGG - Intergenic
1134588730 16:15434808-15434830 TGCGCCTGCGCGGGTGGTCGCGG + Intronic
1135656684 16:24256281-24256303 TGTGCGAGCGCGTGTGCTGGGGG - Exonic
1136399875 16:30011444-30011466 GCCGCGCGCGCGGGCGGGGGCGG - Intronic
1136505315 16:30699041-30699063 CGCGCGTGCGCGGCTGGAGGCGG - Intronic
1136540009 16:30923817-30923839 TGCGCGCGGGCTGGGGGGGGCGG + Intronic
1136546521 16:30957982-30958004 TGCGCGCGCCGGGGAGGTGGTGG + Intronic
1139409262 16:66745818-66745840 TGCTCGAGCTCGGGAGGTGGAGG + Intronic
1139644308 16:68316981-68317003 GGCGGGCGGGCGGGCGGTGGAGG + Intronic
1139705445 16:68737729-68737751 TGGGCTCGCGCGGGCGGTGGGGG + Intronic
1139917886 16:70439252-70439274 GGCGCGCGTGCGGGGGGCGGAGG - Intergenic
1141720042 16:85750979-85751001 CGCCCGGGCGCTGGTGGTGGTGG + Exonic
1141950364 16:87335630-87335652 TGCGTGCTGGTGGGTGGTGGGGG - Intronic
1142421380 16:89972594-89972616 TGCGCGCGCCCGGGCGGCGCGGG + Intergenic
1142704225 17:1684401-1684423 TGCGCGCGCGCAGGCGGGTGGGG - Intronic
1143521223 17:7445411-7445433 TGAGGGCGCGCGGGGGGTGGAGG + Intronic
1144724874 17:17496713-17496735 TGTACGCGCGCGGGAGGTGCAGG - Intergenic
1144816596 17:18039596-18039618 GGCGCGCACGCGCGGGGTGGGGG - Exonic
1145085780 17:19938318-19938340 TGCTCGAGCCCGGGAGGTGGAGG - Intronic
1146313687 17:31790733-31790755 TGCGTGCGCTCGGGAGGTTGAGG - Intergenic
1146601965 17:34225228-34225250 CGCGCGTGCGCGCGTGTTGGGGG - Intergenic
1147168672 17:38605952-38605974 TGCGCGCGCGCGGGCCGGCGCGG + Intergenic
1147990018 17:44326827-44326849 GGCGGGCGGGCGGGTGGAGGCGG + Intergenic
1148284086 17:46372762-46372784 TGCGCGAGGGCGGGCGGCGGGGG + Intergenic
1148306307 17:46590683-46590705 TGCGCGAGGGCGGGCGGCGGGGG + Exonic
1148337524 17:46851560-46851582 GTCCCGCGGGCGGGTGGTGGCGG + Intronic
1148491344 17:48025693-48025715 TGCAAGCTTGCGGGTGGTGGGGG - Intergenic
1151708398 17:75784997-75785019 TGCGCGCGCGGCGGGGGGGGGGG - Intronic
1152363774 17:79844024-79844046 TAAGCGCGCGCGCGAGGTGGGGG + Intergenic
1152377737 17:79927458-79927480 TGCGGGCTCCCGGGTGGGGGCGG + Intergenic
1152455836 17:80415577-80415599 TGCAGCCGCGCGGGTGGAGGAGG + Intronic
1153688343 18:7567755-7567777 TGGGCGCGCGAGGGCGGAGGGGG - Exonic
1155164829 18:23223716-23223738 TGAGTGCGGGTGGGTGGTGGCGG - Intronic
1157263891 18:46200087-46200109 TGTGTGCGCGCGCGTGCTGGGGG + Intronic
1157279027 18:46333939-46333961 CGCGGGCGCGCGGGTGGCGGAGG - Intronic
1157279102 18:46334188-46334210 GGCGCGGGCGCGGGCGGCGGCGG - Intronic
1158427473 18:57352710-57352732 AGCGCGCGCGCGTGTGGCGGAGG - Exonic
1160256327 18:77251073-77251095 TGCTGGCGCGCGGGTGGAAGAGG - Exonic
1160429131 18:78799602-78799624 TGCGCGCGCGCGTGTGCAGTGGG - Intergenic
1160810745 19:1012018-1012040 TGCGAGGGCGCGGGTGGGGGCGG - Intronic
1160834181 19:1116872-1116894 GGCGCGCACGCGGGAGGTGCTGG - Exonic
1160935522 19:1592772-1592794 GGCGCGCGCCCGGCTGGGGGCGG - Intronic
1160941553 19:1622417-1622439 TGCGGGCGGGTGGGCGGTGGGGG + Intronic
1160991676 19:1862863-1862885 GGCGCGCGCGGGGGGCGTGGCGG - Intronic
1160999969 19:1905633-1905655 TGCGCGCGCGCGCGCGGCGCTGG + Intronic
1161015000 19:1979100-1979122 TGCGCGCGCGCGGCGGGGGGCGG + Intronic
1161084037 19:2325736-2325758 TGAGCGGGCGAGTGTGGTGGTGG - Intronic
1161600290 19:5178115-5178137 TGCCGGGGCGGGGGTGGTGGTGG + Intronic
1161802582 19:6424397-6424419 CGCGCGCGCGCAGGCGGGGGAGG - Intronic
1161857192 19:6772746-6772768 TGCGGGCGGGTGGGTGGTGGAGG + Exonic
1162742689 19:12782652-12782674 CGCGCGTGCGTGGGCGGTGGCGG + Intronic
1163118282 19:15200826-15200848 AGCGCCCGCACGGGTGGCGGTGG + Exonic
1165531902 19:36409975-36409997 TGTGCGCGCGTGTGTGTTGGAGG - Intronic
1165838007 19:38771067-38771089 GGCGCGCGTGCGCCTGGTGGAGG - Exonic
1165841558 19:38791630-38791652 GGCGCGCGTGCGCCTGGTGGAGG + Exonic
1165888956 19:39099181-39099203 GGCGCGCGCAGGGATGGTGGGGG + Intronic
1166799984 19:45450894-45450916 TGCGCGGGCGTGGGGGGGGGGGG - Intronic
1168247036 19:55117592-55117614 GGCGGGCGGGCGGGTGGTGGCGG - Intergenic
1168294577 19:55372584-55372606 TGAGAGCGCGGAGGTGGTGGGGG + Intergenic
1168315044 19:55481346-55481368 TGTGCGTGCGCTGGTGGTGCAGG - Exonic
1168408018 19:56120859-56120881 CGCGCGCGTGCGCGTGGCGGGGG - Intronic
926020185 2:9487837-9487859 CGCGCGCGCGCGCGCTGTGGGGG + Intronic
926107494 2:10161435-10161457 CTCGTGCACGCGGGTGGTGGAGG - Intronic
927168736 2:20350847-20350869 TGCGCGCGCCCGGTGGGCGGGGG - Intronic
927667099 2:25040496-25040518 GGGGCGCGGGCGGGAGGTGGAGG + Intergenic
929075703 2:38077153-38077175 TGCGCAGCCGAGGGTGGTGGCGG - Intronic
930872518 2:56183799-56183821 TGCGCCCGGGCGGGTGGGGCTGG - Intergenic
931355785 2:61537305-61537327 TTCGCGTGTGCGGGTGGCGGTGG - Intronic
932429040 2:71663040-71663062 TGCGCGCACGCGCGTGGTGTAGG + Intronic
932496669 2:72148992-72149014 TGTGAGCGCGCGGGTTGGGGCGG - Intergenic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
935240238 2:101171600-101171622 TGGGGGGGCGGGGGTGGTGGTGG - Intronic
936452896 2:112646377-112646399 TGGGCGCGCGCGGGCCGCGGAGG + Intronic
936568440 2:113597290-113597312 TGCCCGCGCTCAGGTGGTTGCGG + Intergenic
937045285 2:118848018-118848040 GGTGCGGGCGCGGGTGGGGGAGG - Intergenic
937203889 2:120223573-120223595 TGCTCGCGCGCGCGGGGTGCTGG - Intergenic
937221747 2:120346071-120346093 GGCGCGGGCGCGGGCGGGGGCGG + Intergenic
937956133 2:127422715-127422737 TGGGCGCGGGCGGGTGGCGCTGG + Intronic
941029132 2:160492802-160492824 ATCGCGTGCGCGGGAGGTGGAGG + Intronic
942748762 2:179264777-179264799 CGCGCGCGCCCGGGTGACGGCGG + Exonic
944413811 2:199464413-199464435 TGCGCGCGCGCGCGTGGAAATGG - Intronic
945080951 2:206085720-206085742 GGCCGGCGCCCGGGTGGTGGAGG - Intronic
945699441 2:213151856-213151878 TGCGCGCGCGCGCGGGCTGGCGG + Intronic
948645153 2:239400207-239400229 TGCGAGCGCCCGGGGGGTCGCGG - Intronic
1169065694 20:2693181-2693203 GGCGGGCGGGCGGGAGGTGGGGG + Intronic
1172064215 20:32207756-32207778 AGCGGGCGCTCGGGTCGTGGAGG + Exonic
1172587327 20:36093716-36093738 TGCGCGCGCGTGTGTGGATGTGG + Intronic
1172618606 20:36306143-36306165 TGCGGGGGCGTGGGTGGGGGTGG + Intergenic
1173167085 20:40692899-40692921 TGCGCGCGCGTGTGTGTTGGTGG + Intergenic
1175429319 20:58891116-58891138 TGCCCGAGCCCGGGGGGTGGGGG + Intronic
1175902939 20:62367128-62367150 GGCGCGGGCGCGGGAGGAGGCGG - Exonic
1176194568 20:63831292-63831314 CGCGCGCGCGCGGGCGGCGGGGG - Intergenic
1176569427 21:8401989-8402011 CGCGCGCGCGCGCGTGCGGGGGG + Intergenic
1178535104 21:33404015-33404037 CGCGGGCGCGCGGGTGGGGGAGG - Intronic
1178610367 21:34073932-34073954 CGCGTGCGCGCGGGAGGCGGGGG + Intronic
1179656582 21:42849759-42849781 TGCGTGTGAGCCGGTGGTGGCGG - Exonic
1180469626 22:15642955-15642977 TGCGGTGGCGGGGGTGGTGGAGG + Intergenic
1182149513 22:28018298-28018320 TGCGCGCGCGGGGGGGGGGGCGG + Intronic
1182709618 22:32312345-32312367 TGCGCGCGCGCGTGTGATTTGGG - Intergenic
1183649445 22:39145655-39145677 TGCGTGCGCGCGGCCGGCGGGGG - Intronic
1184023076 22:41833674-41833696 TGGGCGCGCGAGGGAGGCGGCGG - Intronic
1184276478 22:43411946-43411968 GGCGCGCGGGCGGGCGGCGGAGG + Intronic
1184724582 22:46336078-46336100 TGGGCGCGCGTGGGTGGAGAGGG - Intronic
950509991 3:13420288-13420310 GGCGCGCGCGCGGGCGGGAGCGG - Exonic
954401318 3:50321251-50321273 TGCGCCCGGTCGGGTGGGGGTGG + Exonic
958098162 3:88974018-88974040 TGCGGGAGCGAGGGTGGGGGTGG + Intergenic
959256830 3:104025778-104025800 GGCGGGGGCGCGGGTGGTGGGGG + Intergenic
959359148 3:105367571-105367593 TGCGCCCAGGCGCGTGGTGGAGG + Intronic
960465935 3:117996886-117996908 TGCGCGCGCGCGTGTGAACGGGG - Intergenic
967171795 3:186827569-186827591 TGCGCGAGCGCGGCGGGCGGAGG + Intergenic
968642433 4:1721361-1721383 GGCGCCCGAGCGGGGGGTGGGGG + Intergenic
968701057 4:2058648-2058670 TGCGCGGCCGCGGGGGGCGGGGG + Intergenic
969115499 4:4868474-4868496 TGCGCGGGGGCGGGTGGGGGGGG - Intergenic
972675673 4:41257453-41257475 TGCGCCGGCCCGGGTGGGGGTGG + Intronic
972738474 4:41867311-41867333 TGCGGGCGCGCAGGCGGCGGCGG + Intergenic
976161123 4:82200816-82200838 TGAGCGGCGGCGGGTGGTGGGGG + Intergenic
978072562 4:104491405-104491427 GGCGGGGGCGGGGGTGGTGGGGG - Exonic
978471899 4:109077425-109077447 TGGGGGCGGGGGGGTGGTGGTGG - Intronic
981061274 4:140427652-140427674 CGCGCGTGCGCGTGCGGTGGCGG + Exonic
983158627 4:164383543-164383565 TGCGCGCGCGCCGTTTCTGGCGG - Exonic
987156740 5:15096611-15096633 GGCGGGCGGGCGGGGGGTGGGGG + Intergenic
987175438 5:15303435-15303457 TGCGCGCGTGCGTGTGCTGAGGG + Intergenic
987901087 5:24013051-24013073 CGCGCGCGCGCAGGCTGTGGTGG + Intronic
989033990 5:37150506-37150528 TGTGCGCGCGTGTGTGTTGGGGG - Intronic
989397644 5:40975445-40975467 TGCTTGAGCCCGGGTGGTGGAGG - Intronic
992550074 5:77851557-77851579 TGCGCGCGCGCGCGTGTATGTGG + Intronic
993501852 5:88674625-88674647 CGGGCGCGCGCGGCGGGTGGGGG - Intergenic
994932415 5:106206180-106206202 ACCGCGCGAGGGGGTGGTGGGGG + Intergenic
997237154 5:132279333-132279355 CGCGCGCGCGTGGGTGTCGGGGG - Intronic
998176294 5:139904144-139904166 TGCGTGCGAGCGGGTCGTCGCGG - Intronic
999399363 5:151252834-151252856 TGCGCGCGCGGGAGGGGCGGGGG - Intronic
999868626 5:155728250-155728272 CGTGGGCGCGCGGGAGGTGGCGG + Intergenic
1000665424 5:163989216-163989238 TGTGCGCGCGCGTGTGGGGGGGG + Intergenic
1001065048 5:168529520-168529542 AGCTCGCGCGGGGGCGGTGGGGG + Exonic
1002058006 5:176609830-176609852 TGTGTGCGCGCGGCTGGGGGCGG - Intronic
1002131817 5:177086788-177086810 TGGGCGGGCCCGGGTGGGGGGGG + Intergenic
1002352053 5:178590166-178590188 GGCGAGCGCGCCGGTGGCGGCGG - Exonic
1004193625 6:13486203-13486225 TGCGCGCGCGCGCCTGGGAGAGG - Intronic
1004351959 6:14898002-14898024 TGTGCGCGTGTGTGTGGTGGTGG - Intergenic
1004561804 6:16759968-16759990 TGCGCGCGCGCGCCGGGCGGGGG - Intronic
1006956666 6:37879349-37879371 TGTGGGGGAGCGGGTGGTGGTGG + Intronic
1007361362 6:41358700-41358722 TGGGGGCGGGCGGGGGGTGGGGG - Intergenic
1010442120 6:75906590-75906612 TGCTTGAGCCCGGGTGGTGGAGG + Intronic
1012007522 6:93733174-93733196 TGTGTGCGCCTGGGTGGTGGGGG - Intergenic
1012399524 6:98832712-98832734 CGCGGGTGCGCGCGTGGTGGGGG + Intergenic
1016923386 6:149317623-149317645 GGCGAGCGCGAGGGGGGTGGGGG + Intronic
1018227791 6:161646178-161646200 TGCGTGTGCGTGCGTGGTGGAGG + Intronic
1018227821 6:161646428-161646450 TGCGTGTGCGTGCGTGGTGGAGG + Intronic
1018757485 6:166862730-166862752 TGTGCGCGTGCTGGGGGTGGGGG - Intronic
1018876751 6:167827532-167827554 CGCGCTCGCGGGGGTGGGGGCGG - Intronic
1020201213 7:6081529-6081551 GGCGCGCGCGTGGGTGGGGCGGG - Intergenic
1020281641 7:6653121-6653143 TGCGCGGAGGCGGGTGGTGACGG + Exonic
1021719256 7:23490455-23490477 GGCGGGCGGGCGGGTGGTGTGGG + Intergenic
1024520948 7:50304035-50304057 GGTGCGCGCGGGGGTGGCGGCGG + Intergenic
1025079435 7:55968961-55968983 TGCTCGAGCGCAGGAGGTGGAGG + Intronic
1029103902 7:98158356-98158378 TGCGTGAGCGCAGGAGGTGGAGG - Intronic
1029366397 7:100119269-100119291 TCCCCGCGCTCGGGTGGCGGGGG - Intronic
1029465145 7:100720685-100720707 TGTGCGTGCGCGGGTGGGGGTGG - Intergenic
1029487536 7:100852692-100852714 CGCGCGCGTGCTGGTGGGGGTGG + Intronic
1034147329 7:148884471-148884493 CGTGCGCGCGCGGGCGGCGGCGG + Intergenic
1034617905 7:152435485-152435507 GGCGGGCCCGCGGGCGGTGGCGG - Intronic
1035265988 7:157690572-157690594 AGCGCCCGCGCGGGAGGAGGTGG + Intronic
1036664475 8:10730026-10730048 TGCGCGAGCGTGGGTGCTCGCGG - Intronic
1037900481 8:22685434-22685456 CGCGCGCGCGCGGGGAGGGGAGG + Intergenic
1038729012 8:30110382-30110404 TGCGCGCGTGTGTGTAGTGGGGG + Intronic
1038767910 8:30446844-30446866 CGCGCGCGCGCGCGCGGTGGAGG + Intronic
1039595453 8:38787130-38787152 CGCGCGCGCGGGGGCGGCGGCGG - Intronic
1040661536 8:49582101-49582123 TGCGGAGGCGCGGGTGGTGGTGG + Intergenic
1041864200 8:62550408-62550430 TGTGCGCGTGTGTGTGGTGGGGG + Intronic
1043053279 8:75407535-75407557 TGCGCGCGCCGAGGCGGTGGCGG + Intergenic
1045459017 8:102411578-102411600 TGGGAGCGGGCGGGGGGTGGGGG - Intronic
1045510894 8:102810967-102810989 TGTGCGCGGGCGGGTGTTGCTGG + Intergenic
1045674089 8:104589054-104589076 GGAGCGCGCGCGGGCGGCGGCGG - Intergenic
1046048265 8:108988513-108988535 TGCTTGAGCCCGGGTGGTGGAGG + Intergenic
1047423564 8:124727076-124727098 TGCGCGCGCGCGCGTGGGGGCGG - Intronic
1048484257 8:134832345-134832367 TGTGCGCGCGCGCGTGGGGAAGG + Intergenic
1048484259 8:134832347-134832369 TGCGCGCGCGCGTGGGGAAGGGG + Intergenic
1049509044 8:143018615-143018637 CGCGTGCGCGCAGGTGGCGGGGG - Intronic
1049558642 8:143296515-143296537 TGTGCACGCGCTGGTGCTGGAGG - Exonic
1050325054 9:4490503-4490525 TGCGCGATCCCGGGTGGCGGCGG + Exonic
1051079604 9:13279326-13279348 TGCGCGCGCGCCGGCGGGGAAGG - Intronic
1051513642 9:17906607-17906629 AGCGCGTGCGCTGGGGGTGGGGG - Intergenic
1051630556 9:19136828-19136850 TGCTTGAGCCCGGGTGGTGGAGG - Intronic
1051774810 9:20622058-20622080 TGCGCGCCGGGGGGGGGTGGGGG + Intronic
1057245606 9:93451881-93451903 GGCGCGGGCGCGGGTGCGGGCGG - Exonic
1058058546 9:100473235-100473257 GGCGCGCGCGCGGCGGGCGGGGG - Exonic
1058110737 9:101028865-101028887 TGCGCGCGCCCGTGGGGCGGAGG - Exonic
1059790035 9:117632132-117632154 CGCGCGCGCGCGTGTATTGGGGG - Intergenic
1060283370 9:122228487-122228509 CGCGCGCGAGCGGGGGGGGGGGG - Intronic
1060283374 9:122228491-122228513 AGCGCGCGCGCGAGCGGGGGGGG - Intronic
1060283491 9:122228884-122228906 TGCGCGCGGGCCGGGGGCGGGGG - Intronic
1060376652 9:123120476-123120498 TGCGGGCGGGGGGGTGGGGGGGG + Intronic
1060979724 9:127785428-127785450 AGCGAGCGGGCGGGCGGTGGCGG + Intergenic
1061987056 9:134136055-134136077 TGCGCGTGCGCGAGGGGAGGGGG - Intronic
1062320892 9:135990155-135990177 TGCCCGCGGGCGGGTCTTGGAGG + Intergenic
1203471792 Un_GL000220v1:118426-118448 CGCGCGCGCGCGCGTGCGGGGGG + Intergenic
1185553400 X:1001774-1001796 TGCTTGAGCCCGGGTGGTGGAGG + Intergenic
1186349898 X:8731005-8731027 TGCGCGCGCGCTTGTGTGGGAGG - Intronic
1186545935 X:10449556-10449578 TGCCCACGCGCCGGAGGTGGGGG + Exonic
1187501371 X:19841905-19841927 TGCGGGCGGGGGGGTGGGGGGGG + Intronic
1187547389 X:20267065-20267087 GGTGCGCGCGGCGGTGGTGGCGG - Intronic
1189281290 X:39821468-39821490 TGGGAGCGCGGGGGTGGGGGAGG + Intergenic
1189323039 X:40097648-40097670 TGCCCGAGCGCGGGCGGCGGCGG - Intronic
1189325189 X:40107409-40107431 CGCGCGCGCTTGGGTGGGGGCGG - Intronic
1189325633 X:40109267-40109289 GGAGCGCGCGGGGGTGGGGGTGG - Intronic
1190598841 X:52069425-52069447 TGCGCGCCCGCGGTAGGAGGAGG - Intergenic
1190609983 X:52184648-52184670 TGCGCGCCCGCGGTAGGAGGAGG + Intergenic
1192168846 X:68842213-68842235 TGTGCGTGCGTGTGTGGTGGGGG + Intergenic
1193743224 X:85243859-85243881 CGCGCGCGCGCGGGAGATCGAGG - Intergenic
1195284101 X:103366710-103366732 TGGGGGCGTGGGGGTGGTGGGGG - Intergenic
1195316846 X:103687504-103687526 CGCGCGCGCGTGCGTGATGGTGG + Intronic
1195802562 X:108730313-108730335 TGCGGGGGTGGGGGTGGTGGTGG - Intronic
1197782487 X:130171887-130171909 TGCGCGCGCGCGCGTGAAGGGGG - Exonic