ID: 923783231

View in Genome Browser
Species Human (GRCh38)
Location 1:237043300-237043322
Sequence TGCGCGCGCGCGGGTGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 275}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923783224_923783231 27 Left 923783224 1:237043250-237043272 CCGCTTGCAAAGCGTGGAAGGCA 0: 1
1: 0
2: 0
3: 7
4: 105
Right 923783231 1:237043300-237043322 TGCGCGCGCGCGGGTGGTGGTGG 0: 1
1: 0
2: 2
3: 33
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923783231 Original CRISPR TGCGCGCGCGCGGGTGGTGG TGG Intronic