ID: 923783376

View in Genome Browser
Species Human (GRCh38)
Location 1:237044611-237044633
Sequence CCACTGTGTCACCTCCTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 247}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923783376_923783383 24 Left 923783376 1:237044611-237044633 CCTTGAAGGAGGTGACACAGTGG 0: 1
1: 0
2: 2
3: 23
4: 247
Right 923783383 1:237044658-237044680 GTATAGCATTAACATCTAAAAGG 0: 1
1: 0
2: 0
3: 11
4: 172
923783376_923783382 2 Left 923783376 1:237044611-237044633 CCTTGAAGGAGGTGACACAGTGG 0: 1
1: 0
2: 2
3: 23
4: 247
Right 923783382 1:237044636-237044658 CAGGGGGATTTTTTTTTTTTTGG 0: 1
1: 4
2: 19
3: 223
4: 1614

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923783376 Original CRISPR CCACTGTGTCACCTCCTTCA AGG (reversed) Intronic
904079701 1:27864333-27864355 CCACTGTGTCACTGGGTTCAAGG - Intergenic
904213872 1:28904314-28904336 CCACTGTGTCCCCACTTCCAGGG + Intronic
905034491 1:34908685-34908707 TCATTGTCTCACATCCTTCAGGG - Intronic
905695843 1:39972964-39972986 CCACTGTGACACCTCTCTCCAGG + Intergenic
906661503 1:47586028-47586050 CCTCCTTGTCCCCTCCTTCAGGG - Intergenic
909508086 1:76417810-76417832 CCAATGTGGCTCCACCTTCAGGG + Intronic
912801090 1:112720124-112720146 CCACTATGGCACCTGCTTCCTGG - Intergenic
916721689 1:167489125-167489147 CCACTGTGACACTTCCCTCTTGG - Intronic
916741644 1:167651511-167651533 CCCTTATGTCACCTCCTTCTGGG + Intronic
917370482 1:174288529-174288551 CCACTGTTTCCTCTCCTGCAAGG + Intronic
919656374 1:200201074-200201096 CCCCTGTTGCACGTCCTTCAAGG + Intergenic
920228979 1:204457873-204457895 TCACTGTGCCACCTCCCACAGGG - Exonic
921363849 1:214355620-214355642 CCCCTGTGTCTTCTACTTCAAGG - Exonic
922882935 1:228996268-228996290 CCACAGTGTCCCCTCCACCACGG - Intergenic
923783376 1:237044611-237044633 CCACTGTGTCACCTCCTTCAAGG - Intronic
1063091524 10:2869482-2869504 TCAGTGAGTCACCTCCTTCCTGG - Intergenic
1063301092 10:4849410-4849432 TGACTGTGTCACCTGCTGCATGG - Intergenic
1063348695 10:5335425-5335447 CCAGTCTGTGACCTCCTTGAGGG + Intergenic
1065429453 10:25638699-25638721 CCACTCTCTCACCTCTATCAAGG + Intergenic
1066592464 10:37010345-37010367 CCACATTGTCACCTCCTGCTGGG - Intergenic
1066647074 10:37620888-37620910 CCACTGTGTCTCATTCTACAAGG + Intergenic
1067151916 10:43742829-43742851 TCACTCCCTCACCTCCTTCAAGG + Intergenic
1067523392 10:47024601-47024623 CTACGGTGACACCTCCCTCATGG + Intergenic
1067777202 10:49172287-49172309 TCACTCTGTGAGCTCCTTCATGG - Intronic
1068935983 10:62636265-62636287 CCACAGTGTCACACGCTTCAGGG - Intronic
1069715316 10:70517121-70517143 CAACAGTAGCACCTCCTTCATGG - Intronic
1071509937 10:86255066-86255088 CCACTGTGTCTCCTGCTCCATGG + Intronic
1071564285 10:86663638-86663660 TCACTCTCTCACCTCCCTCAGGG + Exonic
1073374487 10:103021244-103021266 CCACTCTGTCTCCTTCGTCAGGG - Intronic
1073794719 10:106975094-106975116 CCATTCTGTCAACTACTTCAGGG + Intronic
1073928234 10:108542662-108542684 CCACTGTGTCAAATACTTCCTGG - Intergenic
1074630126 10:115244728-115244750 CCACTATGGCACCTTCTTCAAGG + Intronic
1075300938 10:121323614-121323636 ACCCTGAGTCACCTCCTTCCAGG + Intergenic
1075787898 10:125062230-125062252 CCCCTGTGTCCCCCCATTCAGGG - Intronic
1075855564 10:125626635-125626657 CCTCTGTGTCTGCTCCATCATGG - Intronic
1075965717 10:126610007-126610029 CCCCTCTGTCAGCTCCTCCAGGG + Intronic
1076130253 10:128009042-128009064 CTACAGTGTCACCTCCAACATGG + Intronic
1077058627 11:608084-608106 GCGCTGCGTCACCTCCTACACGG + Exonic
1077563495 11:3281184-3281206 CCCCAGTGCCACCTCCTTCCAGG - Intergenic
1077569387 11:3326999-3327021 CCCCAGTGCCACCTCCTTCCAGG - Intergenic
1077659562 11:4055538-4055560 CCACTGTACCACCTCATCCACGG - Exonic
1078428927 11:11272364-11272386 CAACTGTGTCAGCTCCCTAATGG + Intronic
1078665684 11:13323194-13323216 CCAGTGTGTCACCTCCTACCAGG - Intronic
1078869578 11:15330875-15330897 CCACTTTCTCCCCTGCTTCAGGG + Intergenic
1080426698 11:32161475-32161497 CCACTGTGACACTTCTATCAGGG + Intergenic
1080439411 11:32277395-32277417 CCACTGTCTTACATCCTTCTAGG + Intergenic
1080481739 11:32658284-32658306 CCACCGTGCCACCTCTTTCCTGG + Intronic
1081588628 11:44405410-44405432 CCACAGTGTCAGCTCCATGAGGG + Intergenic
1082063396 11:47879539-47879561 CCCCTGTGCCTCCACCTTCAGGG + Intergenic
1083167279 11:60898429-60898451 CCAGTGTCTCTCCACCTTCAGGG + Intronic
1084323791 11:68387724-68387746 CCACTGCGCCTCCTCCATCAGGG - Intronic
1085391676 11:76185358-76185380 CTTCCGTGTCACCTCCCTCATGG - Intergenic
1085895889 11:80639026-80639048 CCACATTGTCACCTCCTGCTGGG + Intergenic
1086178215 11:83918149-83918171 CCACAGTGAGACCTCTTTCATGG - Intronic
1089136890 11:116256384-116256406 CCACTGTTTCCCCTCCTCCCAGG + Intergenic
1089192478 11:116663008-116663030 CCTCTGTGTCACTTGCTTCAGGG + Intergenic
1089526473 11:119100585-119100607 CCCCTATGGCACCTACTTCAGGG - Intronic
1089584902 11:119504118-119504140 CCTCTGTCTCTGCTCCTTCAAGG + Intergenic
1090540670 11:127699982-127700004 CCCCTGTTTCACATCCTGCAAGG - Intergenic
1091227955 11:133969212-133969234 ACACTGTGTGACCTCCTTCGTGG + Intergenic
1096012759 12:48235078-48235100 CCAGTGTGTCAGATCTTTCAAGG + Intergenic
1096216167 12:49798541-49798563 CCTCTGAGTCCGCTCCTTCACGG + Intronic
1096706580 12:53425694-53425716 CCACTGCATGACCTCCTTCCCGG - Exonic
1097178742 12:57158786-57158808 CCCCTGTGTGACCCCCTTCTTGG + Intronic
1101419543 12:104538640-104538662 CCAGATTGTAACCTCCTTCATGG + Intronic
1102529571 12:113536473-113536495 CCACTCTGCCACCTTCTTCCTGG + Intergenic
1103891302 12:124241040-124241062 CCTCTCTGTCACATCCTGCATGG - Intronic
1107025438 13:35796830-35796852 CCACTGTGCCACTTTCATCATGG - Intronic
1108356755 13:49635243-49635265 CCACTGTGTCTATTCCATCAAGG - Intergenic
1112200389 13:97268791-97268813 CCACAGTGTAAACTCCTACAGGG - Intronic
1114393398 14:22334682-22334704 CCTCTGTGTCTCATCCCTCATGG - Intergenic
1114631222 14:24160785-24160807 CCAGGGTGTCAACTCCTTCCTGG - Exonic
1118456313 14:65948281-65948303 CCTCAAGGTCACCTCCTTCAGGG - Intergenic
1118667389 14:68085807-68085829 CCACTGTGGCACGCCCTGCAAGG - Intronic
1119044702 14:71308298-71308320 CTACTTTGTAACCTCTTTCAGGG + Intergenic
1122257037 14:100486021-100486043 CCACTGTGTCCACTTCTTTATGG - Intronic
1122258956 14:100501106-100501128 CCACTGTCACACCTACTCCATGG - Intronic
1125900290 15:43340101-43340123 CCACTTTGTCACATCCCTGATGG - Intronic
1127986667 15:64077809-64077831 CCAATGGGTAACATCCTTCATGG - Intronic
1129113299 15:73350895-73350917 GGACGGTGACACCTCCTTCAAGG - Intronic
1129357637 15:75002288-75002310 CCCCTGTGTCTCCCTCTTCACGG + Intronic
1130010705 15:80151515-80151537 TCACTGTGTCACATTCCTCAAGG + Intergenic
1130461247 15:84159494-84159516 CCACTCTGGCACCCCCGTCATGG - Intergenic
1130874691 15:88003474-88003496 CCAATATGTTACCTACTTCATGG - Intronic
1130881546 15:88060087-88060109 CCACAGGGTGCCCTCCTTCACGG - Intronic
1132021726 15:98368338-98368360 CCACTCAGTCACTTCCTTCCCGG + Intergenic
1132094448 15:98971283-98971305 CCACTTTGTGAGCTCCTTGAGGG - Intronic
1133206795 16:4238919-4238941 CCACCGTGTTACCTTCTTGAGGG + Intronic
1134263694 16:12674562-12674584 CCACTGTGCCACCCCCTTCCAGG - Intronic
1135053472 16:19211467-19211489 CCACCTTGTCATTTCCTTCACGG - Intronic
1136597257 16:31260024-31260046 CCCCTGGTTCACCTCCTTCCAGG + Exonic
1137319962 16:47370516-47370538 CCACTGTAACACCCCCTTTAGGG + Intronic
1138527033 16:57614774-57614796 CTACTGAGTCACCTCCTCCGGGG - Intronic
1139311991 16:66035164-66035186 CCACAGTGTCACTGCCATCAAGG + Intergenic
1139661355 16:68423169-68423191 CCTCCTTGTCACCTCCTTTATGG + Intronic
1140410398 16:74737602-74737624 CCACTCTGTCCCCACCTTCTAGG + Intronic
1141633336 16:85301002-85301024 CCAGTGTGTTCCCTCCTCCAGGG + Intergenic
1142052361 16:87967044-87967066 CCCCTGGGAAACCTCCTTCAGGG - Intronic
1142956664 17:3527513-3527535 CAACCCTGTCACCTCCTCCAGGG + Intronic
1143926043 17:10371507-10371529 GTACTGTGTCAGCTCCTTAAGGG + Intronic
1145064465 17:19752783-19752805 CCACTGTGTCCACACCTTCTGGG + Intergenic
1145814808 17:27787951-27787973 CCCCTGTGGCACCTCCTCCTTGG + Intronic
1147155782 17:38543925-38543947 CCCCGGAGTCACCACCTTCATGG + Exonic
1147636063 17:41965059-41965081 CCACTGCTTCACCACCTTCTCGG - Exonic
1150508205 17:65720495-65720517 CCATTGTGTCAGATACTTCAGGG + Intronic
1151322665 17:73361127-73361149 CCACTTTGTCACGGCCTCCAGGG + Intronic
1151744145 17:76002503-76002525 CCACAGTGTCACCACCTGCAGGG - Exonic
1151965963 17:77431859-77431881 CCACGTTGTCACCTCTCTCAGGG + Intronic
1152569628 17:81116030-81116052 CCACTGGGTCTCGCCCTTCAGGG - Intronic
1152901872 17:82947034-82947056 CCACTGTGGAGCCTCCTCCAGGG + Intronic
1153380300 18:4431011-4431033 CGACTTTGTCTCCTACTTCACGG + Intronic
1154164677 18:12005795-12005817 CCACACTGCCTCCTCCTTCAGGG + Intronic
1154339893 18:13494032-13494054 CCACAGTGCCTCCTCCTTCCTGG + Intronic
1156205834 18:34884524-34884546 CCACTTTGACATCTCCTCCAGGG - Intronic
1157285247 18:46373183-46373205 CCAGGGTGTCATCTCCTTCATGG + Intronic
1157371493 18:47116948-47116970 CCACAGTTTCACCTCTTCCAGGG - Intronic
1157728264 18:49981926-49981948 CCAGTGTTTTACCTCCTACAAGG - Intronic
1158282188 18:55840286-55840308 CCACTGGGTCACCTACCACAGGG - Intergenic
1161107885 19:2453601-2453623 CCAGTGTGTCACCTGCTAAATGG + Intronic
1162488643 19:10977876-10977898 CCACGGTGCCACCTGCCTCACGG - Intronic
1162520703 19:11177919-11177941 CACCTGTGTCTCCTCCTTCTGGG + Intronic
1163353703 19:16795882-16795904 CCACAGTGTCACAGCCTTCCTGG + Intronic
1164143147 19:22492433-22492455 CCCCTGTTGCACATCCTTCAAGG + Intronic
1164872357 19:31656616-31656638 CCACCGTGCCGCCTCCTTCCCGG - Intergenic
1166686545 19:44800090-44800112 CCACTGTGTCACCCCTGTCCAGG + Intronic
1167360954 19:49030109-49030131 CTTCTTTGTCACCTGCTTCAAGG + Intronic
1168101055 19:54141190-54141212 CCACTGTGGCACCTTCTCCTGGG + Intronic
1168241007 19:55088861-55088883 CCACTTTGCCACCTCCTGCCTGG + Intergenic
1168619685 19:57868157-57868179 ACACTGTGCCAGCTGCTTCATGG - Intronic
926796579 2:16624539-16624561 CCACTGTGTCACTGTGTTCATGG - Intronic
927845557 2:26470581-26470603 CCGAGGTCTCACCTCCTTCATGG + Exonic
929192509 2:39152612-39152634 CCACTGAGTTTCCTCCTTGAAGG + Intergenic
932569907 2:72933134-72933156 ACACTGTGTGGTCTCCTTCAGGG - Intronic
932789089 2:74637775-74637797 CCACTGTCTCTAGTCCTTCAGGG + Intronic
933839149 2:86272373-86272395 CCACTTTGTAACATACTTCAAGG + Intronic
937900809 2:127017627-127017649 CCACTGTGTCCCTTCTTTGAAGG - Intergenic
938316322 2:130331801-130331823 CAACTGTGTGACCTCCTTGTTGG + Intergenic
938797463 2:134730486-134730508 CCGCTGGAGCACCTCCTTCAGGG - Intergenic
943211910 2:184977664-184977686 CCAGTGTGTCAGCTCCTTCCTGG - Intergenic
943795325 2:191985935-191985957 ACACTGTGTCACATTCTTCTGGG - Intronic
945466154 2:210171943-210171965 CAAATTTGTCACCTACTTCAGGG - Intergenic
948182041 2:235989718-235989740 CCACTGACCCACCTCCTCCAGGG - Intronic
1168816640 20:742256-742278 CCACTGTGTTGCCTCCTTGAAGG - Intergenic
1169241443 20:3984481-3984503 CCACTGCCTCACTTCCTTTAAGG + Intronic
1169260594 20:4135543-4135565 TCCCTGGGTCACCTCTTTCAGGG + Intronic
1170389392 20:15855222-15855244 TCGCTGTGTCACCCTCTTCAGGG + Intronic
1170391626 20:15881056-15881078 CCACTTTGTGACCTCCTTGAGGG + Intronic
1170511926 20:17086303-17086325 CCACTGTGTTACATCTTTCTTGG - Intergenic
1170595026 20:17798758-17798780 TCACTGTTTCAACTCCTCCAGGG - Intergenic
1170942141 20:20857154-20857176 CCTCAGTGGCACCTCCTGCATGG - Intergenic
1171194873 20:23189235-23189257 GGACTGTGTCTCCTCCTCCACGG - Intergenic
1172163471 20:32884644-32884666 GCACTGTGACCCCTCCTCCAGGG - Intronic
1172450816 20:35021331-35021353 CCATTGTGTTCCCTCCTCCAGGG - Exonic
1172592122 20:36125222-36125244 TAACTGTGTCCCCTCCTTCTGGG - Intronic
1172878201 20:38179203-38179225 ACATTGTGTCACCTTCTCCATGG - Intergenic
1173565957 20:44038945-44038967 CCTCCGTGTCTCCTCCTTCCTGG + Intronic
1173764516 20:45595537-45595559 CCAGTGTGGCACACCCTTCAAGG - Intergenic
1173943828 20:46934327-46934349 CCTCTGTGTCACCTTCCTCCTGG + Intronic
1175194260 20:57231508-57231530 AGACTGTGCCACCTCCTTCAGGG - Intronic
1175832249 20:61971786-61971808 CCACTGTGTGCCCACCCTCAGGG - Intronic
1176185941 20:63779095-63779117 TCACTTTATCACTTCCTTCAAGG + Intronic
1177145084 21:17398711-17398733 TCACTGACTTACCTCCTTCAGGG + Intergenic
1178620175 21:34167376-34167398 CCACTGTGGCACCAGCTACATGG - Intergenic
1178704891 21:34864902-34864924 CCACTGTGTTTCCACCTTCATGG - Intronic
1179029000 21:37703674-37703696 CCACTGGGCCACCACCTTCCTGG + Intronic
1179586246 21:42375739-42375761 CACCCGTGTCACCTCCTTCCTGG - Exonic
1182531144 22:30959244-30959266 CCACTGGTTCCCCTCCTTGAAGG + Intronic
1182848034 22:33447485-33447507 CCACTGTGCCCCTTCCTTCCGGG - Intronic
1184801767 22:46765275-46765297 CCTCTGTGACTCCTCCTTCAGGG - Intronic
1185181599 22:49366606-49366628 CCACCGTGGCACCTGCCTCATGG - Intergenic
949545526 3:5069046-5069068 CCACTGTGGGACCTCCTGCACGG - Intergenic
950722890 3:14897550-14897572 CCAATGTGTCTCTGCCTTCATGG - Exonic
951067882 3:18288924-18288946 CCACAATCTCACCTCCTTGAGGG + Intronic
953796872 3:45992685-45992707 CCCCTTTCCCACCTCCTTCAAGG - Intronic
955552085 3:60096009-60096031 ATCCTGTGTCAACTCCTTCAAGG - Intronic
958258260 3:91349595-91349617 CAATTGTGTCACGTCCTTCCTGG - Intergenic
958871453 3:99563757-99563779 AAACTGTGTCAACTCCTTGAGGG + Intergenic
960144817 3:114189784-114189806 CCACAGTGTCACCTTCTTCCAGG - Intronic
961548597 3:127653209-127653231 AAACTGTCTCACCTGCTTCAGGG + Intronic
961982204 3:131092151-131092173 CCACTCTGTCACCATCGTCATGG + Intronic
964651504 3:159016298-159016320 CCACTGGGTAACCACCTTCTCGG - Intronic
964819430 3:160754878-160754900 CCACTGAGTCCCCTACTCCAGGG + Intergenic
965374310 3:167903383-167903405 ACACTGGGTCAGCTCCATCAAGG + Intergenic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
968653996 4:1770861-1770883 CCACTGTCTCAGCTCCCTGAGGG + Intergenic
968982155 4:3856046-3856068 CCACTGTGTCCCCGCTCTCAGGG + Intergenic
969086045 4:4657249-4657271 TCACAGTGTTACCTACTTCATGG + Intergenic
969122124 4:4918457-4918479 CAACAATGTCACATCCTTCAAGG + Intergenic
969171878 4:5370558-5370580 GCTCTGTGTCACCTGCTTCTTGG - Intronic
971508270 4:27390453-27390475 CTACTGTGTTATCTCCTCCAAGG - Intergenic
979519238 4:121647488-121647510 CCCCTCTCTCATCTCCTTCAAGG + Intergenic
980560374 4:134465037-134465059 CCACTGCCTCACCTCCTTTGTGG - Intergenic
981538562 4:145825121-145825143 ACACTGTGTCCCCTCCTTCACGG - Intronic
983421290 4:167520642-167520664 TCACTGTTTCACTTCTTTCATGG + Intergenic
985027916 4:185757632-185757654 TCACTGTCTCAACTCCTTCCAGG + Intronic
986658321 5:10036986-10037008 CCACTGTGACCACTCCTTCTTGG + Intergenic
986701082 5:10409361-10409383 TCACTCTCTCAACTCCTTCAGGG - Intronic
990533713 5:56699355-56699377 ACACTATAACACCTCCTTCAAGG + Intergenic
992169254 5:74085972-74085994 CCACTCTGCCACCTCCTACTGGG + Intergenic
992477218 5:77115472-77115494 CAATTGTGTCAAGTCCTTCAAGG - Intergenic
994027607 5:95102764-95102786 CTAATGTATCACCTCCTTAAGGG - Intronic
994184563 5:96803834-96803856 TAACTGTGTCCACTCCTTCATGG - Exonic
994191669 5:96875787-96875809 CCATTGTGATCCCTCCTTCAAGG - Intronic
995280476 5:110330332-110330354 TCTCTGTATCACCTCCTTCAGGG + Intronic
995617102 5:113977275-113977297 TCACATTGTCAGCTCCTTCAGGG + Intergenic
996476221 5:123925298-123925320 CCATTTTGCCACCTCCTTCTTGG + Intergenic
998129633 5:139645012-139645034 GCAGTCTGTGACCTCCTTCATGG + Intergenic
998256419 5:140591994-140592016 CCACTCTCTCCCCTCCCTCAAGG + Intronic
999722853 5:154411766-154411788 CCACTGTGGCATCTGCTTCTTGG - Intronic
1000154176 5:158534500-158534522 GCACTGGGCCACCTGCTTCATGG - Intergenic
1000477140 5:161724808-161724830 CCATATTCTCACCTCCTTCAAGG - Intergenic
1000957643 5:167561468-167561490 ACACTGTCTGACCTCCGTCATGG - Intronic
1001065250 5:168530314-168530336 CCACTTTCTCATCTCCATCAAGG + Exonic
1001841810 5:174882530-174882552 CCACTGTGTCATCTCGAGCAAGG + Intergenic
1002291632 5:178204596-178204618 CAACTGTGTCTCCTCCTCCTTGG - Exonic
1004834019 6:19510618-19510640 GCACTGTTTCATCTCCTTCAGGG + Intergenic
1006097783 6:31666509-31666531 CCTCTGTGTCAACTCCGGCAGGG - Intronic
1006639781 6:35484062-35484084 CCCGAGTGTCACCTCCTCCAGGG + Intronic
1006786026 6:36667870-36667892 CCATTGTGTTACCCCCTCCAGGG - Intergenic
1008663895 6:53697066-53697088 TCAATGTGTTACCTCCATCAGGG - Intergenic
1011421773 6:87180908-87180930 CCTCTGTCACACCTCCTGCAAGG - Intronic
1011535796 6:88374685-88374707 CCACTCTGACACATGCTTCAGGG - Intergenic
1013416121 6:109926190-109926212 CCACTGTGTCTCCTGCCTCGAGG - Intergenic
1015643124 6:135358822-135358844 CCCCTGTGTCACGTCCTGAAAGG - Intronic
1016424405 6:143918387-143918409 CCACTGTGTTTCATCCTCCATGG + Intronic
1016901935 6:149111656-149111678 CAACTGTGCCACCTACCTCATGG + Intergenic
1018485752 6:164239445-164239467 CCCCTGTGTAAAATCCTTCAGGG + Intergenic
1018580175 6:165301703-165301725 CCACTATGTCAGCTCCTACCTGG - Exonic
1018826581 6:167412301-167412323 CCAATGAATCACCTGCTTCAGGG - Intergenic
1019819272 7:3229339-3229361 CCACTGTCTCCTCTCCTTCTTGG + Intergenic
1021982339 7:26067025-26067047 TCACTGTATCACCTCCTGCAAGG + Intergenic
1022242798 7:28529298-28529320 CCACCTTGGCACCTCCTTCGGGG - Intronic
1023686075 7:42736982-42737004 CTACTGTGACACCTCCTGCTGGG - Intergenic
1024346333 7:48318253-48318275 CCACTTTGCCACCTACCTCAGGG + Intronic
1026846834 7:73703399-73703421 CCTGTGTGCCACATCCTTCAGGG + Intronic
1026922848 7:74169286-74169308 CTACTGTGTGACCTCCAGCAAGG - Intergenic
1028068552 7:86419610-86419632 CCACTGTGTCATTTTCCTCAAGG + Intergenic
1028552363 7:92083618-92083640 ACACTGTATCACTGCCTTCAAGG - Exonic
1029575941 7:101403286-101403308 CTTGTGTGTCCCCTCCTTCATGG + Intronic
1033647508 7:143316420-143316442 CCACTGTCTCCCCTCATCCATGG - Intronic
1034552720 7:151831860-151831882 CCACTCTGTCACCTCCCTAGCGG - Intronic
1035327755 7:158075881-158075903 CCGCTGTGTCACGTCCTCCATGG - Intronic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1037926782 8:22849914-22849936 CACATGTGCCACCTCCTTCACGG - Intronic
1038456364 8:27674318-27674340 CCACCGAGGCACCTCCATCATGG - Intronic
1038655446 8:29446722-29446744 CCATTTTGCCACTTCCTTCATGG - Intergenic
1039775684 8:40733886-40733908 CCAAGGTGTCAGCACCTTCAGGG - Intronic
1046433620 8:114160026-114160048 CCACTGAGTCAGTCCCTTCATGG - Intergenic
1046869911 8:119194529-119194551 CCCCAGTGTCAACTGCTTCAAGG + Intronic
1047197923 8:122738263-122738285 CCCATGTGTCACATGCTTCAGGG - Intergenic
1047234268 8:123025529-123025551 CCATTGTGTCTCCTCCAGCATGG + Intronic
1048524490 8:135189497-135189519 CCTCTGTGTAACCTCCTTCCTGG + Intergenic
1049460414 8:142724738-142724760 CCACTGTGTCCTCTCCTGCCAGG - Intergenic
1050268189 9:3913468-3913490 GCTCTGTGTGACCTCCATCATGG - Intronic
1050278017 9:4020111-4020133 TGACTCTCTCACCTCCTTCAAGG - Intronic
1050955146 9:11647436-11647458 ATAATGTGGCACCTCCTTCAGGG - Intergenic
1052348983 9:27438835-27438857 CCAAAGTGTCAACTCCTTGAGGG + Intronic
1053167875 9:35857264-35857286 CCACCGTGTGAGCTCCTTCAGGG - Intergenic
1053662106 9:40291262-40291284 CCACTGTGTGACCTCAGGCAGGG + Intronic
1053912555 9:42921430-42921452 CCACTGTGTGACCTCAGGCAGGG + Intergenic
1054374233 9:64437502-64437524 CCACTGTGTGACCTCAGGCAGGG + Intergenic
1054522504 9:66085022-66085044 CCACTGTGTGACCTCAGGCAGGG - Intergenic
1059826203 9:118031747-118031769 CCTCTTTATCACCTCCTTCAAGG - Intergenic
1061263103 9:129490758-129490780 TCACAGTCCCACCTCCTTCAAGG + Intergenic
1186242264 X:7582126-7582148 CTACTGTGGCATCTCCTTTATGG + Intergenic
1187008443 X:15254843-15254865 TGACTGTTTCCCCTCCTTCAGGG - Exonic
1193917243 X:87379960-87379982 TCCCTGTGTCATTTCCTTCATGG - Intergenic
1198893774 X:141428485-141428507 CCAGTCTGTCACCCCCTCCAAGG + Intergenic
1199936111 X:152575164-152575186 CCACTGGCTCACCTTCTACAAGG + Intergenic
1200056782 X:153465768-153465790 CCACTGGGTCTCCTCCTTCAGGG + Intronic
1200118487 X:153779675-153779697 GCACTGAGTCAGCTCCTGCAGGG - Intronic
1202378009 Y:24255650-24255672 CCACTCTGGCACCCCCGTCATGG + Intergenic
1202492773 Y:25414471-25414493 CCACTCTGGCACCCCCGTCATGG - Intergenic