ID: 923789260

View in Genome Browser
Species Human (GRCh38)
Location 1:237097584-237097606
Sequence TCCATTTTGGTCTCCTATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923789260 Original CRISPR TCCATTTTGGTCTCCTATAC TGG (reversed) Intronic
903517409 1:23920973-23920995 TCCATTTCGGTCTGCTCTATTGG - Intergenic
906198292 1:43943357-43943379 TCCTTTTTGGTTTCCTTCACTGG - Intergenic
907253461 1:53159675-53159697 TCCATTTTGTGCTGCTATAAAGG - Intergenic
907867796 1:58415485-58415507 TCCATTTTTGTCTCCTTTCTAGG - Intronic
908689231 1:66758755-66758777 TCCATTTTGGTCACTTTTACTGG - Intronic
909052517 1:70783616-70783638 TCCATTTTGCATTGCTATACAGG + Intergenic
916790989 1:168125002-168125024 TCCATTTTGTGTTGCTATACAGG - Intronic
918225167 1:182474604-182474626 TCCCATCTGGTCACCTATACTGG + Intronic
919342933 1:196336886-196336908 TCCTCTTTGGTCTCCTTTGCTGG + Intronic
920163644 1:204019361-204019383 TCCATTTTGCTTTCTTATAAAGG - Intergenic
921063530 1:211606689-211606711 TCCCTTTCTGTCTCCTTTACTGG + Intergenic
922645920 1:227286677-227286699 TCCATTTTGAACTGCTATAAAGG + Intronic
923789260 1:237097584-237097606 TCCATTTTGGTCTCCTATACTGG - Intronic
924657373 1:245985132-245985154 TCCCTTTTGGTCTCCCGTCCTGG + Intronic
1067208161 10:44237161-44237183 TCTATTTGGGGCTCCTCTACAGG + Intergenic
1067367833 10:45651700-45651722 TCCATTTCTGTTCCCTATACTGG + Intronic
1067773740 10:49146159-49146181 TCCATGTTGCTCTCCTATCTGGG + Intergenic
1070383091 10:75899329-75899351 TCCATGTCTGTCTCCTCTACTGG - Intronic
1072650827 10:97293862-97293884 TCCATATTGTTTTCCTATGCTGG + Intergenic
1075771405 10:124940352-124940374 TCAGTTTTGGTCTCCTTTACAGG + Intergenic
1076431402 10:130405502-130405524 TTCATTTTTGTCTCCACTACTGG - Intergenic
1077763425 11:5129740-5129762 TGCTTTTTGGTCTTCTTTACAGG - Intergenic
1079905726 11:26244637-26244659 TGCATTTTGGTCATGTATACAGG - Intergenic
1080240800 11:30125154-30125176 TTCATTTTGTTCTCCAATTCAGG - Intergenic
1080831024 11:35893360-35893382 TCCATTTTGCATTCCTATAGAGG - Intergenic
1081538449 11:44012899-44012921 TCCTTCTTGGTGTCCTTTACTGG + Intergenic
1081943665 11:46968194-46968216 TCCATTTTGGTTTAGTCTACTGG + Intronic
1082125029 11:48422308-48422330 CCCCTTTTGATTTCCTATACTGG + Intergenic
1082558694 11:54593572-54593594 TCCCTTTTGATTTCCTATACTGG + Intergenic
1084578730 11:70008897-70008919 TCCATGTGGGTCTCCTGGACAGG - Intergenic
1085539859 11:77256927-77256949 TCCATTTTGTTTTGCTATAAAGG - Intronic
1086409857 11:86534124-86534146 TCATTTTAGGTGTCCTATACAGG - Intronic
1086903774 11:92396361-92396383 TGCCTTTTTGTCTCATATACAGG + Intronic
1087340208 11:96896355-96896377 TACATTTTGGTTTCTTATACTGG + Intergenic
1087613217 11:100458549-100458571 TCCTTCTTGGTCTCCTTTGCTGG - Intergenic
1088271708 11:108041155-108041177 TCCTTTCTTGTCTCCTCTACAGG + Intronic
1089288474 11:117422755-117422777 TACATATTGGATTCCTATACAGG - Intergenic
1089584846 11:119503751-119503773 TCCATTTTGCATTGCTATACAGG - Intergenic
1096768800 12:53918680-53918702 TCCATTTTGTGCTGCTATAACGG + Intergenic
1097202285 12:57289476-57289498 TCCATTTCTGTCTCCTACATTGG + Intronic
1097524733 12:60717504-60717526 TCCAGGTTGGCCTCCCATACAGG - Intergenic
1103747458 12:123135151-123135173 GCCTTTGTGGTCTCCTAGACTGG - Intronic
1105404234 13:20120143-20120165 TCCATTTTGGTCTGGCCTACTGG - Intergenic
1105955445 13:25277961-25277983 TTAATTTTGGTCAGCTATACAGG + Intronic
1105979678 13:25505845-25505867 TCCTTTATATTCTCCTATACAGG + Intronic
1110047484 13:70848460-70848482 TCCATTTTGGTTTGCTCTATTGG - Intergenic
1110609335 13:77471568-77471590 TGCATTATAGTCTCCTAAACTGG - Intergenic
1112065467 13:95788091-95788113 TACATTTCTGTCTCCTTTACTGG - Intronic
1112065471 13:95788166-95788188 TACATTTCTGTCTCCTTTACTGG - Intronic
1112615915 13:101005196-101005218 TCCATTTTGTGCTGCTATAATGG - Intergenic
1113012430 13:105785010-105785032 TCCATTTTGCTTTGCTATAAAGG - Intergenic
1113016424 13:105833232-105833254 TCCATTTTGGTCTTCTAAAAAGG - Intergenic
1115329971 14:32186592-32186614 TCCAATATGGTCTCCTTTGCTGG + Intergenic
1118501956 14:66370321-66370343 TCCATGTTGGTCTCTGCTACTGG - Intergenic
1119119705 14:72063228-72063250 TCCTTTTCGGTCCCCTTTACTGG - Intronic
1119563981 14:75613151-75613173 TCCATTTTGGATTGCTATAAAGG + Intronic
1119571561 14:75678464-75678486 TCCAATTTAGTCTTCTATAGTGG + Intronic
1120586969 14:86323725-86323747 TCCATTTTGATCTCCTTTACCGG - Intergenic
1124716863 15:32071865-32071887 TCCATTTTGTGCTGCTATAAAGG - Intronic
1133649939 16:7803118-7803140 TCCTTTTTGGTCTTCTCTATAGG - Intergenic
1137890047 16:52150589-52150611 TTCATTTTGGTTTCCTCTGCTGG + Intergenic
1138114629 16:54350608-54350630 TCCATTTTGCTGTGCTATAAAGG + Intergenic
1139231308 16:65285133-65285155 TCCCTTTGGGTTTCCTATAGAGG + Intergenic
1144469696 17:15526986-15527008 TCCATTTTGGTTTGGTCTACTGG - Intronic
1144926654 17:18816669-18816691 TCCATTTTGGTTTGGTCTACTGG + Intergenic
1149895241 17:60423869-60423891 TCCATTTTGCATTCCTATAAAGG + Intronic
1149965252 17:61156247-61156269 TTCATTTTGGTCTTCTTTTCAGG + Intronic
1151666571 17:75548796-75548818 CCCATTCTGGTCTCCTACAGTGG + Intronic
1154232514 18:12570175-12570197 TCCATATTTGTCTCCTTTGCTGG + Intronic
1159998964 18:74997695-74997717 GCCATTTTCTTCTCCTATAAAGG + Intronic
1160248158 18:77177102-77177124 TCCATTTTGTGCTGCTATAAAGG - Intergenic
927597715 2:24411793-24411815 TCCATTTTGTGCTGCTATAAGGG - Intergenic
928311077 2:30210483-30210505 TCCATGTTGGGCTGCTATAAAGG + Intergenic
929826682 2:45314251-45314273 TCCTTCTTGGTCTCCTTTGCTGG - Intergenic
930540644 2:52702457-52702479 TCCATTTTGTGCTGCTATATAGG + Intergenic
930900774 2:56505307-56505329 TCCATTTTGGCCTCCGAAAGTGG + Intergenic
934479783 2:94625566-94625588 TACATTTTGTTTTCCCATACAGG + Intergenic
938023835 2:127927605-127927627 TCCATTTTGGTTTGGTCTACTGG + Intergenic
941175434 2:162192436-162192458 TCCTTCTTGGTCTCCTCTCCAGG + Intronic
941715118 2:168755641-168755663 TCCATTTTGGCTTCCTATTTGGG - Intronic
943948595 2:194099459-194099481 TCCATTTTATTATCCTAAACTGG + Intergenic
944977066 2:205065901-205065923 TCCATTTTGTGTTCCTATAATGG - Intronic
947101334 2:226624680-226624702 TCCATTTTGCATTGCTATACAGG + Intergenic
1169855143 20:10093995-10094017 TCCATTTTTCTCTCCCCTACCGG - Intergenic
1177209938 21:18058806-18058828 TCCCTTTTTGCCTCCTTTACAGG + Intronic
1183499139 22:38167989-38168011 TCCATTTTGTTCTGCCACACAGG + Intronic
1183819814 22:40337111-40337133 TCCAATCTGGTCTCCTATTTTGG - Intergenic
951639216 3:24815888-24815910 TCTATCTTGGTCTTCTATAAAGG + Intergenic
953566999 3:44041222-44041244 TCCATTTTGGTTTTCTACTCTGG + Intergenic
953753301 3:45625866-45625888 TCCATTTTGTGCTACTATAATGG - Intronic
954248335 3:49349248-49349270 TGCTTTGTGGTCTCCTCTACTGG + Intergenic
960521504 3:118660531-118660553 TCCATTTTGCATTCCTATAAAGG - Intergenic
960981914 3:123237438-123237460 TCCATTTTGGAGACTTATACTGG + Intronic
961959973 3:130844681-130844703 TTTTTTTTGGTCTCCTCTACTGG - Intergenic
963031954 3:140987502-140987524 TCCATTTTGCACTCCTGTAAAGG - Intergenic
967065664 3:185912941-185912963 TCCATTTTAGTCTCCAAAATAGG - Intergenic
971657132 4:29363109-29363131 TGCATTTTCTTCTCCTACACTGG + Intergenic
976589681 4:86836647-86836669 TCCATTTTGTGCTGCTGTACAGG - Intronic
981102386 4:140843755-140843777 TCAGTTTTTTTCTCCTATACTGG + Intergenic
982038697 4:151373276-151373298 TCCATTTTGCACTGCTATAAAGG + Intergenic
984065771 4:175045908-175045930 TCCATTTTTGTCCCCTTTAGAGG + Intergenic
987485737 5:18523300-18523322 TCCATATTGATCCCCTTTACAGG - Intergenic
987593191 5:19959979-19960001 TCCTTTTTAGCATCCTATACAGG - Intronic
989540825 5:42616759-42616781 TCTTTCTTGGTCTCCTTTACTGG - Intronic
989578367 5:43009708-43009730 TCCATTTTTGTCTCCCAGGCTGG - Intergenic
990617955 5:57526663-57526685 TCCATTTTGCATTTCTATACAGG - Intergenic
991099006 5:62771039-62771061 TCCATTTTGGATTGCTATAAAGG - Intergenic
992645118 5:78804657-78804679 CCCATTTTTGTCTCCTCTCCAGG - Intronic
993864595 5:93177116-93177138 TCCATTTTGTGCTCTTACACTGG - Intergenic
994148353 5:96420196-96420218 TCCATTTTCTTCCCCTAAACTGG - Intronic
995256027 5:110047926-110047948 TTCATTTCGCTCTCCTAAACAGG + Intergenic
996741151 5:126800214-126800236 TCCATGTCTGTCTCCTACACTGG - Intronic
996912075 5:128667747-128667769 TCCATGTTGGTCTCTGATGCTGG + Intronic
996912319 5:128669808-128669830 TCCATGTTGGTCTCTGATGCTGG + Intronic
998067117 5:139168721-139168743 CCTGTTTTGGCCTCCTATACTGG - Intronic
998452098 5:142242619-142242641 TCCATTTTGTATTCCTATAAAGG - Intergenic
999972978 5:156883442-156883464 CCTATTTTGGTCTCCTACACTGG - Intergenic
1001171154 5:169420049-169420071 TCTTTTTTGGCCTCCTATCCTGG - Intergenic
1004118380 6:12794114-12794136 TCCATTTTGTTCTCATAAATAGG - Intronic
1006237918 6:32651879-32651901 TTCATTTTGGTTTCCCTTACTGG - Intergenic
1006289661 6:33125023-33125045 TGCTTTTTGGTCTCCTTCACGGG - Intergenic
1007937547 6:45746794-45746816 TCAATTCTTGTCACCTATACTGG + Intergenic
1010843800 6:80680086-80680108 TCCCTTTTTGGCTCCTCTACTGG + Intergenic
1012436622 6:99221797-99221819 TCCTTTTTGGTCTACCATATTGG + Intergenic
1013360867 6:109392937-109392959 TCCATTTTTTTCTCCTATGTAGG - Exonic
1013406446 6:109848210-109848232 TCCACCTTGGCCTCCCATACTGG - Intergenic
1014175484 6:118326819-118326841 TCTATTTTGGGCTCATTTACAGG - Intergenic
1015577931 6:134692373-134692395 TCCATTTTGTTCTTCTATGAAGG - Intergenic
1017228975 6:152051956-152051978 TCCATTTTGTGCTGCTATAAAGG + Intronic
1018006178 6:159624166-159624188 TCCATTTTGCTTTGCTATAAAGG - Intergenic
1020595645 7:10204284-10204306 TGCATTTTAGTCTCCTCCACAGG - Intergenic
1022199521 7:28103157-28103179 TCCTTCTTGGTCTCCTTTACTGG + Intronic
1022561162 7:31351375-31351397 TGCATTTTGGCCGCCAATACTGG + Intergenic
1026269643 7:68825030-68825052 TCCATTTTACACTGCTATACAGG - Intergenic
1026277323 7:68891517-68891539 TCCATTTTGTGTTCCTATAAAGG + Intergenic
1026454871 7:70562207-70562229 TCCATTTTGTGCTGCTATAAAGG - Intronic
1026486221 7:70824001-70824023 TGCATTTTGGTTTGCTATAAAGG + Intergenic
1029198865 7:98825640-98825662 TCCATTTTGTTTTGCTATATGGG - Intergenic
1030887983 7:114962459-114962481 CCCATTTTGTTCTCCCATAAGGG + Intronic
1037063690 8:14548794-14548816 CCCAATTTGGTCTCATATGCAGG - Intronic
1037152805 8:15657794-15657816 TCCATTTTGGGCTGCTGTAACGG + Intronic
1037897793 8:22669678-22669700 TTCCCTTTGGTCTCCTCTACAGG + Intergenic
1041512515 8:58667613-58667635 TCCACTTTTGTGTCCTATTCAGG + Intergenic
1041894265 8:62905767-62905789 TCCTTTTTGGTCTCTTTTGCTGG + Intronic
1042992819 8:74659690-74659712 GCCATTTTGGCCTCCTAAAGTGG + Intronic
1044684643 8:94815151-94815173 TCCATTTTGTGCTGCTATAATGG - Intronic
1045205136 8:100031119-100031141 TACATTTTGTTTTCCTCTACTGG - Intronic
1045392243 8:101726954-101726976 TCCTTTTTGTTCTCCTTTACTGG - Intronic
1048355224 8:133648191-133648213 TTCATTTTGCACTCCTATAAAGG - Intergenic
1048571216 8:135658539-135658561 TCCTTCTTGGTCTCCTTTTCTGG - Intergenic
1049552128 8:143265078-143265100 TCCATTTTGCACTGCTATAAAGG + Intronic
1050674793 9:8039668-8039690 ATCATTTTGGTCTCCTTTATAGG - Intergenic
1050809462 9:9725597-9725619 TCCATTTTTGTCTCATATTCTGG + Intronic
1053287172 9:36857302-36857324 TCACTTTTAGACTCCTATACTGG + Intronic
1054705895 9:68461779-68461801 TCCATTTTGTGCTCTTATAATGG - Intronic
1057061060 9:92004132-92004154 TCCATTTTCCTCTCCCCTACAGG + Intergenic
1057112352 9:92485231-92485253 TCCATTTTTGTTTCCTAAAGGGG + Intronic
1059087982 9:111325119-111325141 TCCATTTTGTTGTCCCATTCTGG + Intergenic
1059779757 9:117514098-117514120 ACAATTTTAATCTCCTATACTGG + Intergenic
1060365066 9:123003555-123003577 TACATATTGTTTTCCTATACTGG - Intronic
1061360043 9:130135592-130135614 TTCATTTTTGTCTCCCAAACAGG - Exonic
1186050390 X:5586825-5586847 TCCATTTTGGTAAGCTATAGGGG + Intergenic
1187543148 X:20219071-20219093 TCTGTTTTGGTTTCCTATTCTGG - Intronic
1189611088 X:42736569-42736591 TCTATTTTGGTCTCCTAAGCTGG + Intergenic
1193469306 X:81879386-81879408 TCAATTTTGTTTTCCTATAGTGG + Intergenic
1193628103 X:83844487-83844509 TCCATTTTGTACTTCTATAAAGG + Intergenic
1194298769 X:92159995-92160017 TCCATTTTGGTTTGCTCTACTGG + Intronic
1196470279 X:116016240-116016262 TCAATTTTGGATTCCTATAAAGG + Intergenic
1197939432 X:131774165-131774187 CCCATTTTGGTGTCCTTTGCAGG - Intergenic
1197940987 X:131789659-131789681 ACCATTTTGGTGTCCTTTGCAGG - Intergenic
1199005314 X:142689235-142689257 TCCATTTTGGACTACGATACGGG + Intergenic
1199005319 X:142689313-142689335 TCCATTTTGGACTACAATATGGG - Intergenic
1200616382 Y:5384974-5384996 TCCATTTTGGTTTGCTCTACTGG + Intronic