ID: 923794228

View in Genome Browser
Species Human (GRCh38)
Location 1:237137657-237137679
Sequence ATCCATTTGAATAAGTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923794228 Original CRISPR ATCCATTTGAATAAGTAGGA AGG Intronic
908122093 1:60995710-60995732 ATCTATTTGACTGAGTAGTATGG + Intronic
909781026 1:79547740-79547762 ATACAATTGTATAAGTAGGCTGG + Intergenic
911882543 1:103259622-103259644 ATGTGTATGAATAAGTAGGAGGG + Intergenic
916578816 1:166089797-166089819 ATCCCTTGGACTCAGTAGGAGGG + Intronic
917190351 1:172411003-172411025 GTCCATTTGAGTAGGTAGGTAGG + Exonic
918809368 1:189095322-189095344 ATCCAGTTGAATCAGAAAGAAGG - Intergenic
919292603 1:195651623-195651645 ATTCATCTGAATAAGTATTAAGG - Intergenic
919447641 1:197728906-197728928 ATACATTTAGATAGGTAGGATGG - Intronic
921138919 1:212286447-212286469 ACCTGTTTGAATAAGGAGGAGGG - Intronic
923794228 1:237137657-237137679 ATCCATTTGAATAAGTAGGAAGG + Intronic
923878149 1:238073529-238073551 AATCATTTGAAAAAGTTGGAGGG + Intergenic
1063025721 10:2177455-2177477 ATTCATTCGAAGAACTAGGAAGG - Intergenic
1063294005 10:4783107-4783129 ATCCATTTCAATAAGAAACAAGG - Intergenic
1063833813 10:9988184-9988206 AGCTATTTGAAAAAGCAGGACGG + Intergenic
1068962733 10:62881905-62881927 AACCATTTAAGTAATTAGGAAGG + Intronic
1069295663 10:66841427-66841449 ATCCATTTGAATGAATTGGAAGG - Intronic
1070451968 10:76568183-76568205 ATCCATTTGTATAAAAAGAAGGG - Intergenic
1073153377 10:101327530-101327552 AGACATTTGCATAAGTAGCAAGG + Intergenic
1074262662 10:111870016-111870038 AGAAATTTGCATAAGTAGGAAGG + Intergenic
1076199293 10:128545668-128545690 TTCCATTTTAATTAGTAGAAAGG + Intergenic
1078534991 11:12165761-12165783 ATCTATTTGGAGAAGAAGGACGG + Intronic
1079469209 11:20762543-20762565 ATTCATTTGAAAAAGTTGCATGG + Intronic
1081041670 11:38221782-38221804 GTCCATTTGAATAGGGAGGGGGG + Intergenic
1083045242 11:59728672-59728694 ATACATTGGAATATGGAGGAAGG - Intronic
1086766295 11:90699609-90699631 ATCCATTTGAATAGTTAATATGG - Intergenic
1086969600 11:93066145-93066167 AGACATTTGCATAAGTAGCAAGG - Intergenic
1090033688 11:123229738-123229760 GTCCATTAAAAAAAGTAGGATGG + Intergenic
1096936038 12:55277608-55277630 TGCCATTTGAATCAGAAGGAAGG + Intergenic
1097538023 12:60898524-60898546 ATATATATGAATAAGTAGGATGG + Intergenic
1098313025 12:69166241-69166263 AAATATTTGAAGAAGTAGGAGGG - Intergenic
1098315825 12:69192483-69192505 AAGAATTTGAATAAGTGGGAAGG - Intergenic
1099475010 12:83097589-83097611 ATCCTTTTTAATAAATAGAAGGG - Intronic
1099901922 12:88721781-88721803 ATGCATTTGAGTAAGAAGGTGGG - Intergenic
1108812609 13:54247264-54247286 CTCCATTTTATTAAATAGGATGG - Intergenic
1109086162 13:57973505-57973527 AGACATTTGCATAAGTAGCAAGG - Intergenic
1109221660 13:59646611-59646633 AGACATTTGTATAAGTAGCAAGG + Intergenic
1109560866 13:64048271-64048293 ATGCATTTTAATAAATAGTAAGG - Intergenic
1109626996 13:64987579-64987601 ATCCATTTTAATAAGTTTGCTGG + Intergenic
1109627003 13:64987724-64987746 ATCCATTTTAATAAGTTTGCTGG - Intergenic
1110066409 13:71112442-71112464 AACAATTTGAACAAGTTGGATGG - Intergenic
1110156800 13:72326577-72326599 ATCATTTTGACTAAGTGGGAAGG - Intergenic
1110981254 13:81901796-81901818 ATCCATTTTGATAATTTGGAGGG + Intergenic
1113961114 13:114126613-114126635 CTACACTTTAATAAGTAGGAGGG - Intronic
1115706131 14:35999961-35999983 ATCCATTTGGATGGGAAGGAAGG - Intergenic
1116010114 14:39341512-39341534 ATCCATTCTAAAAAGAAGGAAGG + Intronic
1116478103 14:45365169-45365191 ATCCATTTGAAAAATTGGCAGGG - Intergenic
1121297046 14:92836597-92836619 ATGCATTTGAATAAATAGTGTGG - Intronic
1202847487 14_GL000009v2_random:193406-193428 ATCCATATGAATTGGTAGGAAGG + Intergenic
1202916954 14_GL000194v1_random:183964-183986 ATCCATATGAATTGGTAGGAAGG + Intergenic
1125997161 15:44173389-44173411 ATCTATTTGAAAGAGGAGGAGGG + Intronic
1129604925 15:77020189-77020211 CTCCATTTGTAGAACTAGGAAGG + Intronic
1131743814 15:95422945-95422967 ATTCATTTGAGTAAATATGAAGG - Intergenic
1131788443 15:95938063-95938085 ATGCGTTTGAATAGGTAGGCTGG - Intergenic
1133812494 16:9171499-9171521 ATACATATAAATAGGTAGGATGG + Intergenic
1135519950 16:23168450-23168472 ATCAATTTAAATTAGCAGGAGGG - Intergenic
1135782947 16:25322225-25322247 ATCCAGATGAAGAAGGAGGAGGG - Intergenic
1137451236 16:48576719-48576741 ATGACTTTGAAAAAGTAGGAAGG - Intronic
1138518582 16:57555763-57555785 AACCATATCAATAAGTAAGAGGG - Intronic
1139501507 16:67370126-67370148 ATCTATTGTAATAAGAAGGAAGG + Intronic
1142057699 16:88009567-88009589 CTCCACTGGAATAAGAAGGATGG + Intronic
1145856277 17:28161517-28161539 ATCTAGGTGAATAAGCAGGATGG + Intronic
1147571615 17:41575138-41575160 AACCATTTGAGAAAGTAGAAAGG - Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153657239 18:7293887-7293909 ATCCATTAGAACAAGTGAGATGG + Intergenic
1154322509 18:13366603-13366625 ATCCTTCTGAATAAATATGAAGG + Intronic
1155034027 18:22009013-22009035 ATCCACTAGAATCAGGAGGATGG - Intergenic
1155721784 18:29022745-29022767 ATACATTTTAATATGAAGGAAGG - Intergenic
1156940921 18:42766625-42766647 AGAAATTTGCATAAGTAGGAAGG + Intronic
1158310981 18:56158046-56158068 CACCATTTGAAAAAGTAAGAAGG + Intergenic
1158683778 18:59594221-59594243 ATTCATTTGTAGAAGGAGGACGG - Intronic
1159145105 18:64444198-64444220 ATGCATTTGGATGTGTAGGAAGG + Intergenic
1159496650 18:69216198-69216220 TTCCATTTCAATAAGAAGGAAGG - Intergenic
1167423714 19:49418583-49418605 GTCCATGTGAATAAGAGGGAGGG - Intergenic
1202674830 1_KI270710v1_random:33580-33602 ATCCATATGAGTTGGTAGGAAGG + Intergenic
927656374 2:24950341-24950363 ATCAAGGTGAAAAAGTAGGAAGG + Intronic
928143095 2:28747874-28747896 ATCCATTTCAGTGAGCAGGATGG + Intergenic
932266483 2:70371543-70371565 ATCCATTAGAACCAGTGGGATGG - Intergenic
933123312 2:78570906-78570928 ATGCATTTGAATAAACAGCAAGG - Intergenic
933371476 2:81420569-81420591 ATCCATTTGAGGAAGTACTATGG + Intergenic
933811368 2:86034780-86034802 CTTCATTTGAAAAAGTAGGCAGG + Intronic
935108249 2:100066774-100066796 CTCCTTTTGAATGAGTAGAAAGG - Intronic
935448813 2:103186955-103186977 ATAAATTTGCATAAGTAGCAAGG + Intergenic
935871556 2:107456035-107456057 ATGAATTTGAATAAGAAGGTGGG - Intergenic
939546013 2:143553681-143553703 AACCATTTGAAAAAGTAGTATGG - Intronic
940109543 2:150136415-150136437 GTCCATTTGAATATTTTGGAGGG - Intergenic
941021870 2:160415965-160415987 ATTCAGTTGAATATGTATGAAGG + Intronic
941457132 2:165722238-165722260 ATCCAGTTTAATAAGGAAGAGGG - Intergenic
943324768 2:186485093-186485115 ATCAATTTGACTAAGTAGGGGGG + Intergenic
944991676 2:205244824-205244846 ATCCATTTGAATGTGAAGAAGGG - Intronic
946106430 2:217374091-217374113 ATGCATTTGAATTAGTTTGATGG - Intronic
947683853 2:232062878-232062900 ATCCATGTGAAAAGGAAGGAAGG - Intronic
1169595137 20:7189934-7189956 AGCCATTTGAGTAAACAGGAAGG - Intergenic
1170082271 20:12490257-12490279 ATTCAACTGAATAATTAGGAAGG + Intergenic
1170395325 20:15919726-15919748 CTCCATTTGAAAAAGAAGAAGGG + Intronic
1171002847 20:21432180-21432202 ATTCATTTGCAAAAGAAGGAAGG - Intergenic
1174685642 20:52452494-52452516 ATTCAGTTGAATAAGAAAGAAGG - Intergenic
1175124312 20:56740101-56740123 ATCCATTTGAATAAATAAGGAGG - Intergenic
1176522132 21:7832259-7832281 ATCCATTTGGAGATGTAGGCAGG - Intergenic
1176637107 21:9256601-9256623 ATCCATATGAGTTGGTAGGAAGG - Intergenic
1178240320 21:30892321-30892343 ATCCCTTAGAATAAGGAGGTGGG - Intergenic
1178481164 21:32980200-32980222 ATGCATTTGAGGAAGTATGATGG - Intergenic
1178656152 21:34462271-34462293 ATCCATTTGGAGATGTAGGCAGG - Intergenic
1179535840 21:42051338-42051360 TTCTATTTGAATAAGGATGATGG - Intergenic
1180846783 22:18987316-18987338 ATACATATAAATAAGTAGGCTGG + Intergenic
1182178569 22:28319759-28319781 TTCCATTTGAATAATTTGAAGGG + Intronic
1182942949 22:34295586-34295608 AGCAAGCTGAATAAGTAGGAGGG + Intergenic
949237541 3:1828251-1828273 GTCCATATAAATAAGGAGGATGG - Intergenic
949318058 3:2778682-2778704 ATGCATTATAATAAGTTGGATGG - Intronic
951069473 3:18309837-18309859 ATACCTTTTAATAAGTATGAAGG + Intronic
954641707 3:52104121-52104143 ATCCATTTGATTAAATAAAAAGG + Intronic
957525172 3:81371179-81371201 ATCCATTAGAGCTAGTAGGAAGG - Intergenic
961294395 3:125872964-125872986 ATCCATTTGCATGAGCTGGAGGG + Intergenic
961985509 3:131128652-131128674 ATTCATTTGAATAAATACCAAGG + Intronic
964302671 3:155306459-155306481 ATCCATATAAAAAAGTATGATGG - Intergenic
964956373 3:162362696-162362718 ATCCATTAGTTTAAGTAGGAAGG - Intergenic
965043283 3:163538932-163538954 ATCCATTTTGTTAAGTTGGATGG + Intergenic
965550090 3:169955751-169955773 ATGCAGTTGAGCAAGTAGGAGGG - Intergenic
966071819 3:175887195-175887217 ATCCATTTGAATATTTATAAAGG + Intergenic
966446636 3:180007984-180008006 AGAAATTTGAATAAGTAGCAAGG - Intronic
966741923 3:183242266-183242288 AGACATTTGCATAAGTAAGATGG + Intronic
967689481 3:192457756-192457778 AGAAATTTGAATAAGTAGCAAGG + Intronic
1202749787 3_GL000221v1_random:148418-148440 ATCCATATGAGTTGGTAGGAAGG + Intergenic
970499033 4:16658142-16658164 TTCCAATTCAATCAGTAGGATGG + Intronic
971434746 4:26608709-26608731 GTACATTTGAATAATTAGCAGGG + Intronic
971904932 4:32714595-32714617 ATCCATTTGATTAAATAGTATGG - Intergenic
971939436 4:33196389-33196411 ATGCATTTTTAGAAGTAGGATGG + Intergenic
972753437 4:42017245-42017267 ATCCATTAGAAAAAATAGGAAGG - Intronic
972906910 4:43761164-43761186 ATCCATTTGAATAGAAAGTAGGG - Intergenic
972943720 4:44227877-44227899 ATATATTAGAATAAATAGGACGG - Intronic
973072536 4:45882217-45882239 ATCCATTTGAAAATGTACAAGGG + Intergenic
974186718 4:58456718-58456740 TTACATGTGAATAAGCAGGAGGG - Intergenic
978853425 4:113365882-113365904 ATCCATTTTAATAGGATGGAAGG - Intronic
979145077 4:117236442-117236464 ATACATTTCAGTAATTAGGATGG - Intergenic
980298678 4:130958375-130958397 ATCCATTTAGATAAATAGGTAGG + Intergenic
980866349 4:138557327-138557349 ATGCATTTGAATATGTGGGGGGG + Intergenic
981231848 4:142365854-142365876 ATCAATTTGTATAATCAGGATGG - Intronic
981257880 4:142684511-142684533 GTCCTTTTGCCTAAGTAGGAGGG - Intronic
982925264 4:161329313-161329335 ATCCTTTTGAATACTTATGAGGG + Intergenic
983182388 4:164663559-164663581 TTCCTTTTGAATCATTAGGATGG - Intergenic
1202751998 4_GL000008v2_random:15028-15050 ATCCATATGAGTTGGTAGGAAGG - Intergenic
986972398 5:13352461-13352483 ATGAATCTTAATAAGTAGGATGG - Intergenic
988067349 5:26238182-26238204 ATACATTCTATTAAGTAGGAAGG - Intergenic
988248798 5:28726699-28726721 CTACATTTGAAGAAGCAGGAAGG - Intergenic
988418689 5:30978644-30978666 ATCCATATGACGAAGGAGGATGG + Intergenic
992453255 5:76892291-76892313 ACCAATTTGAAAGAGTAGGATGG - Intronic
993469520 5:88289557-88289579 ATCCTTGTGAGTAAGTTGGAGGG + Intergenic
994734841 5:103539795-103539817 ATCCAATTGAATAGGTAGAATGG + Intergenic
995662190 5:114497566-114497588 ATCCATTGGACTATGTAGGGTGG - Intergenic
995721239 5:115135779-115135801 ATCTATTTGAAAAAATAAGACGG + Intronic
996237511 5:121150003-121150025 GCAAATTTGAATAAGTAGGAAGG + Intergenic
999012248 5:148055892-148055914 ATAAATTTGCATAAGTAGCAAGG + Intronic
999925345 5:156369783-156369805 AACCATTTGACTAATTAGAATGG + Intronic
1000030551 5:157397547-157397569 AGCAATTTGCATAAGTAGCAAGG - Intronic
1001917058 5:175570569-175570591 CTGCATTTGAATAAGTAAGTGGG + Intergenic
1008548718 6:52606281-52606303 GCCCATTTGAAGAAGTATGAAGG - Intergenic
1008550172 6:52621264-52621286 ATACATTTTAAAAAGTAGGTTGG + Intergenic
1008860980 6:56150024-56150046 ATCAATTTGGATATGGAGGAAGG - Intronic
1009053511 6:58307364-58307386 ATCCATTTAAAAAATTATGATGG + Intergenic
1009237604 6:61143181-61143203 ATCCATTTAAAAAATTATGATGG - Intergenic
1010768196 6:79799884-79799906 CTGTATTTGAATGAGTAGGATGG + Intergenic
1011135830 6:84099803-84099825 ATCCATTTGCATTAGTACAAAGG - Intergenic
1012217740 6:96608796-96608818 TTCCTTTTGAAGAGGTAGGAAGG - Intronic
1012301173 6:97590270-97590292 AACTATATGAATAAGGAGGAAGG - Intergenic
1012721219 6:102748166-102748188 TTCCATTTGAATAAGTTACATGG + Intergenic
1013020200 6:106207130-106207152 ATACATTTGAAAAAGTAACAAGG - Intronic
1016769044 6:147828264-147828286 CTCCATGTGAATAATCAGGAAGG + Intergenic
1017170895 6:151453054-151453076 ATCCATTTGCATAAATCGAATGG + Intronic
1017828467 6:158101362-158101384 ATTCATTTGGGTAAATAGGAAGG + Intergenic
1020321916 7:6945084-6945106 ATCCATTTGCATGAGCTGGAGGG - Intergenic
1021020314 7:15590025-15590047 ATTCATTTGAATAAATACCAAGG - Intergenic
1021620525 7:22546713-22546735 ATTCATTTTAATATGTAGTAGGG - Intronic
1022402210 7:30050236-30050258 ATACATTTGTATAAATAAGAAGG + Intronic
1025888020 7:65617060-65617082 ATCCATTTAAAAAAGAAGGGAGG - Intergenic
1031174985 7:118338845-118338867 ATAAATTTGCATAAGTAGCAAGG + Intergenic
1031769646 7:125828075-125828097 GTCCATCTGAATAGGTATGAAGG + Intergenic
1032256946 7:130305103-130305125 ATCCAGTTGAATGAATAAGAAGG + Intronic
1033438311 7:141354603-141354625 ATATGGTTGAATAAGTAGGAAGG - Intronic
1033844955 7:145420632-145420654 ATTCATTTGAGTAAATATGAAGG - Intergenic
1035791497 8:2309771-2309793 ATTCATCTGAAGAAGTAGAATGG + Intergenic
1035801308 8:2411934-2411956 ATTCATCTGAAGAAGTAGAATGG - Intergenic
1038412191 8:27367451-27367473 GTCCATTTCAACAAGGAGGAAGG + Intronic
1039267161 8:35838232-35838254 ATACATCTTAATAAGTGGGATGG - Intergenic
1041990362 8:63981755-63981777 ATTGATTTGATTAAATAGGATGG + Intergenic
1043076807 8:75711628-75711650 AATCATTTGACCAAGTAGGAAGG - Intergenic
1044579545 8:93811130-93811152 AGACATGTGAATAAGTAGGGTGG + Intronic
1044601725 8:94011974-94011996 ATCCTTTGGAACAAGGAGGAAGG + Intergenic
1046129209 8:109946410-109946432 AGACATTTGGATAAGTAGCAAGG + Intergenic
1047570056 8:126087905-126087927 ATCCATTTGAATCACTCAGAGGG - Intergenic
1048903725 8:139066392-139066414 ATACATTAGAATAAATATGAAGG + Intergenic
1050936456 9:11401886-11401908 ATTCATTTGGATAAATAAGAAGG + Intergenic
1052912387 9:33894998-33895020 ATCCATTTCAATAATAGGGAAGG - Intronic
1058035876 9:100252101-100252123 ATACATATGAATAGGAAGGAAGG + Intronic
1203718430 Un_KI270742v1:178505-178527 ATCCATATGAGTTGGTAGGAAGG + Intergenic
1203652644 Un_KI270751v1:142200-142222 ATCCATATGAGTTGGTAGGAAGG + Intergenic
1185893585 X:3840496-3840518 AGAAATTTGCATAAGTAGGAAGG + Intronic
1185898700 X:3878920-3878942 AGAAATTTGCATAAGTAGGAAGG + Intergenic
1185903817 X:3917349-3917371 AGAAATTTGCATAAGTAGGAAGG + Intergenic
1188765070 X:34080729-34080751 ATAAATTTGCATAAGTAGCAAGG - Intergenic
1188925132 X:36031640-36031662 TTCCATTTGTATAAGGAGAATGG - Intergenic
1189609649 X:42718763-42718785 ATCCATTTAATTAAATAGGTTGG - Intergenic
1191259758 X:58303726-58303748 TTCCATTTGATTCAGTAGGTTGG + Intergenic
1192094206 X:68193299-68193321 ATTCAATTGAAAAAGGAGGAAGG + Intronic
1193308979 X:79982591-79982613 ATCCAGTGGCATAAGTAAGATGG - Intergenic
1194626058 X:96227735-96227757 ATAAATTTGCATAAGTAGCAAGG - Intergenic
1195725171 X:107907474-107907496 TTCCATTTTAATCAGAAGGAAGG - Intronic
1196143259 X:112289111-112289133 ACCCAGTCGAATAAGTACGAAGG + Intergenic
1201172580 Y:11283355-11283377 ATCCATATGAGTTGGTAGGAAGG + Intergenic
1201779244 Y:17700283-17700305 AACCAGTTGAATAAAAAGGAAGG + Intergenic
1201822312 Y:18205709-18205731 AACCAGTTGAATAAAAAGGAAGG - Intergenic
1202341937 Y:23878760-23878782 ATTCATATCAAAAAGTAGGAAGG - Intergenic
1202528831 Y:25791325-25791347 ATTCATATCAAAAAGTAGGAAGG + Intergenic