ID: 923795187

View in Genome Browser
Species Human (GRCh38)
Location 1:237147315-237147337
Sequence CTCTTACAGTAATAGAAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923795187_923795192 1 Left 923795187 1:237147315-237147337 CCCTATTTCTATTACTGTAAGAG 0: 1
1: 0
2: 1
3: 18
4: 237
Right 923795192 1:237147339-237147361 AAAAGGGTGTGCACCTGTTCTGG 0: 1
1: 0
2: 1
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923795187 Original CRISPR CTCTTACAGTAATAGAAATA GGG (reversed) Intronic
901141479 1:7035796-7035818 CGTTTACACTAATAGAAATTCGG + Intronic
901372269 1:8809543-8809565 GTCTTAGAGTCATTGAAATATGG - Intronic
901418354 1:9132921-9132943 CTCTTGCAGAAATAGAAAAACGG - Intergenic
904922825 1:34022026-34022048 ATCTTAGAGTCAAAGAAATATGG + Intronic
906397133 1:45476151-45476173 CTAATACAGTAACAGAAAAATGG + Intronic
907037699 1:51230734-51230756 CTTTTACAGAAATACAAATATGG - Intergenic
908590053 1:65621632-65621654 CTCTTACAGTCCTAGCAAAATGG - Intronic
909485080 1:76163536-76163558 GTCTTACAGTAAATGAACTATGG - Intronic
909528491 1:76654496-76654518 GTCTTCCATTAAAAGAAATAAGG - Intergenic
910267952 1:85360143-85360165 CTTCTAAAGTAATAAAAATATGG + Intronic
910903141 1:92144333-92144355 GTTATACAGTAATACAAATATGG + Intronic
911007078 1:93237526-93237548 CTCTTGCTGTAATAGAAACCTGG + Intronic
911225526 1:95301066-95301088 CTCTTGCAGTATTGAAAATAGGG + Intergenic
912074743 1:105859437-105859459 TTTTTAAAGTAATAGAAGTAAGG - Intergenic
915702678 1:157811130-157811152 CTCTTAAAATAATAGAAATATGG - Intronic
917193878 1:172446513-172446535 TTCTAACAGTACTAGAAATCTGG + Intronic
917493531 1:175519110-175519132 CTGTTACAGAAAGAGAAATGAGG - Intronic
917822673 1:178780310-178780332 GTAGTACAGTAATAGAAATAAGG - Intronic
918972828 1:191442710-191442732 CTCTAACAGTTAAAAAAATATGG - Intergenic
922274502 1:224064711-224064733 TTATTACAGTAATAGAACTTTGG + Intergenic
922570782 1:226633714-226633736 CCCTTGCAGATATAGAAATAGGG - Exonic
923486750 1:234439824-234439846 CTCTCTCAGTAATAGATACAAGG + Intronic
923523859 1:234757632-234757654 CTCTTATATTAAAATAAATAAGG - Intergenic
923795187 1:237147315-237147337 CTCTTACAGTAATAGAAATAGGG - Intronic
924018311 1:239752320-239752342 CTCTGACAGAAATAGAACAATGG - Intronic
1064104633 10:12490497-12490519 TTCTTAAAGTGATAGAATTAGGG + Intronic
1064536077 10:16359303-16359325 TTGTTAAAGGAATAGAAATAAGG - Intergenic
1065062679 10:21922055-21922077 TAATTACAGGAATAGAAATAGGG + Intronic
1065404224 10:25345436-25345458 TTATAACATTAATAGAAATATGG - Intronic
1067821559 10:49535651-49535673 ATTTTACAGAAATAGAAAAATGG - Intronic
1068062002 10:52079846-52079868 CTTTTACATTATTAGATATATGG + Intronic
1069208394 10:65723210-65723232 GAATTACAGTAATAGAAATAAGG + Intergenic
1069254775 10:66318936-66318958 CTCTTAAAGTAATAGGGAAAGGG - Intronic
1070191501 10:74115779-74115801 CTCTGATAGAGATAGAAATAAGG + Intronic
1072731251 10:97848810-97848832 CTCTTAAAAAAATAAAAATAAGG - Intergenic
1073649428 10:105342894-105342916 CTCTGACAGTAAAAGACTTATGG - Intergenic
1074734478 10:116414489-116414511 CTTTTACAGTAATAGAGTTGAGG + Intergenic
1075952756 10:126496229-126496251 CTCTTTCAGTTATATGAATAGGG - Intronic
1079547627 11:21653133-21653155 CTCTTACCTCAATATAAATAAGG - Intergenic
1079794807 11:24788134-24788156 CTGTTACAGTGAAAGAATTAAGG - Intronic
1080153992 11:29086533-29086555 CTCTTACTTTGATTGAAATAGGG + Intergenic
1084925464 11:72507974-72507996 GTCTTACAACAATAGTAATATGG - Intergenic
1086267127 11:85014065-85014087 TTCTTACAGTAAAACAAACAAGG + Intronic
1087041038 11:93800234-93800256 CTTTTACATTAATAGACTTAGGG - Intronic
1087384981 11:97459749-97459771 CTCTCACAGTAATCCAAATGAGG - Intergenic
1087674074 11:101138834-101138856 CTCATACAGAATTAGGAATAAGG + Intergenic
1087957446 11:104306082-104306104 ATTTTACAGTAAGACAAATAAGG - Intergenic
1088448371 11:109955795-109955817 CTCTCACTGTTATTGAAATAGGG + Intergenic
1088615669 11:111625148-111625170 CTCTTACATGAATAAAATTAGGG + Intronic
1088763222 11:112951504-112951526 CTATAACAGTAATAATAATAAGG - Intergenic
1089325927 11:117656959-117656981 CTCTAAGAGAAATAAAAATAAGG + Intronic
1091295267 11:134469614-134469636 CCCTTCCTGTAATAGAAATCTGG + Intergenic
1091313695 11:134595813-134595835 TTATTACAGAGATAGAAATAAGG - Intergenic
1091572993 12:1706866-1706888 CTCTCAAAGTGATGGAAATATGG - Intronic
1093312912 12:17613542-17613564 ATCCTTCAGTAATAGAAAAATGG - Intergenic
1095552320 12:43457763-43457785 CTATTTCAGTGATAGAAGTAAGG - Intronic
1099295714 12:80825540-80825562 CTGTTACAGTGATGGAAACAGGG + Intronic
1099719776 12:86346028-86346050 TTCTTACAGAAATAGCAAAAAGG + Intronic
1100221599 12:92510130-92510152 CTTTTGCAGTAGTAGCAATAAGG - Intergenic
1100663190 12:96722721-96722743 CTATTATAATAACAGAAATATGG + Intronic
1100793938 12:98160038-98160060 CCCTTACAGTAACAGTAACAAGG + Intergenic
1101295833 12:103423047-103423069 CTGTAACAGAAATAAAAATAAGG + Intronic
1104527342 12:129536695-129536717 ATATTCCAGTAATAGAAAGAGGG - Intronic
1105289629 13:19043362-19043384 CTCTTACTGTTATATTAATAAGG + Intergenic
1108083551 13:46761795-46761817 TTCTTACAGGAATCTAAATAAGG + Intergenic
1109259230 13:60123314-60123336 CTCTTTTAGAAATACAAATATGG - Intronic
1110059564 13:71024510-71024532 CACATACAATAATAGAATTAAGG + Intergenic
1110927675 13:81175792-81175814 CTACTACAAAAATAGAAATAAGG - Intergenic
1112775780 13:102842920-102842942 CTTTAACAGTAATAGCAGTAGGG - Intronic
1114422206 14:22593842-22593864 GACTTACAGTCATAGAAAGAGGG + Intergenic
1117141595 14:52795420-52795442 CTATTACAGTAGTAGAAAATAGG + Intergenic
1117334830 14:54748277-54748299 CTCCTACAGTGATAGGAAAATGG - Intronic
1118245094 14:64102420-64102442 CTCAGACAGGAATAAAAATAAGG + Intronic
1125750824 15:42027026-42027048 CACTTACAGTATGAGAAATGTGG + Intronic
1132182678 15:99771050-99771072 CTCTTACAGTAACAGTATTCTGG - Intergenic
1134558239 16:15184778-15184800 ATCTTACAGTATTAGAATTCAGG + Intergenic
1134918771 16:18096380-18096402 ATCTTACAGTATTAGAATTCAGG + Intergenic
1138464979 16:57183005-57183027 CTCATTCAGTAAAAGACATAAGG + Intronic
1138889190 16:61121613-61121635 ATCTTAGAGTAATCCAAATATGG - Intergenic
1144194963 17:12883861-12883883 CTCTTTCAGTTAGAGAAGTAAGG - Intronic
1146265933 17:31452770-31452792 CTGTCACAGTAACAGAAATGTGG - Intronic
1147506115 17:41019210-41019232 CTATAATAATAATAGAAATAAGG - Intronic
1149930112 17:60743294-60743316 AACTTAAAGTAATAGAAATCAGG + Intronic
1150661111 17:67080317-67080339 CTGATACAGAAATAGAAACACGG - Intronic
1150669836 17:67183291-67183313 CTCTTTCAGAGAGAGAAATAGGG - Intronic
1153747637 18:8196357-8196379 CTCTAACAGTAATAGCACTAAGG - Intronic
1154485062 18:14866613-14866635 CTGTTAGAGTAGTAGAAAGATGG + Intergenic
1156297393 18:35805381-35805403 ATCTTACTGTGATAGAATTATGG - Intergenic
1156688119 18:39674351-39674373 CTATTAGAGGAACAGAAATAGGG + Intergenic
1156738616 18:40295864-40295886 CTCTTATAGTATTACAACTATGG - Intergenic
1157849832 18:51038029-51038051 CTCCCACAGTGCTAGAAATATGG - Intronic
1158090414 18:53705588-53705610 CTGTTACAGTAACAGAAAACAGG - Intergenic
1160355410 18:78224022-78224044 CTCTTACTGTGATATAATTAAGG - Intergenic
1164014964 19:21247007-21247029 CTGCTACAGTAATGGAAATATGG + Intronic
1164021558 19:21311828-21311850 CTGCTACAGTAATAAAAATATGG + Intronic
1164028226 19:21373467-21373489 CTGCTACAGTAATGGAAATATGG - Intronic
1164076324 19:21822206-21822228 TTGCTACAGTAATGGAAATATGG + Intronic
1164094393 19:21993229-21993251 CTGCCACAGTAATGGAAATATGG + Intronic
1164102639 19:22071174-22071196 CTGCTACAGTAATGGTAATATGG - Intronic
1164140201 19:22453397-22453419 CTGCTACAGTAATGAAAATATGG - Intronic
1164183976 19:22845573-22845595 CTGCTACAGTAATAAAAATATGG - Intergenic
1164198094 19:22990558-22990580 CTGCCACAGTAATGGAAATATGG + Intronic
1164224786 19:23234075-23234097 CTGCTACAATAATGGAAATATGG + Intronic
926894709 2:17672429-17672451 CTATTACTGTAATAAAAAAATGG - Intronic
926924564 2:17974092-17974114 ATCTTACAGAGGTAGAAATAGGG - Intronic
927739331 2:25553425-25553447 AGCTCACAGTAATAAAAATACGG + Intronic
928315618 2:30242608-30242630 ATGTTTCAGTGATAGAAATATGG - Intronic
928675744 2:33649302-33649324 CTCTTACAGGCATAGACAAAAGG - Intergenic
929712796 2:44281664-44281686 TTCTGAAAGAAATAGAAATAAGG + Intronic
930372145 2:50515357-50515379 ATGTAATAGTAATAGAAATAAGG + Intronic
931633330 2:64320736-64320758 CTCTTTGATTATTAGAAATAAGG - Intergenic
933467344 2:82670439-82670461 CTCTTTCAGTACTAGATAAAAGG + Intergenic
933860736 2:86464642-86464664 CTCTAAGAATAATAGAAATGAGG + Intronic
935007965 2:99100281-99100303 CTTTTACAGTTATAGTAATTAGG + Intronic
935579376 2:104743580-104743602 CTCTTACAGCATAAGAAATCAGG + Intergenic
938008562 2:127809908-127809930 ATCTTACAGTAATAAAAAATGGG + Intronic
939330043 2:140746187-140746209 CTCTAACAGTGAAAGAAATGTGG + Intronic
939547490 2:143571220-143571242 ATGTAACAATAATAGAAATAAGG + Intronic
939716539 2:145590922-145590944 CTTTTACAGTAGTGGAAAAAAGG - Intergenic
939896987 2:147803532-147803554 CTCATAAAGTATTAGGAATATGG - Intergenic
940428611 2:153559826-153559848 CTTTTTCAGTAAGAAAAATAGGG + Intergenic
941187315 2:162333023-162333045 CTCTCACAAAAATAGAAATATGG + Intronic
941722636 2:168828011-168828033 CTCATAGAGAAATTGAAATAAGG + Intronic
943074903 2:183182134-183182156 GTTTTACAGAAATAGAAAAAAGG - Intergenic
943502904 2:188714044-188714066 CTCTCATAGTTATAAAAATAAGG - Intergenic
944637732 2:201690968-201690990 CTCTTACAGACGAAGAAATAAGG + Intronic
944745367 2:202650421-202650443 CTTTAAAAGTAATAAAAATATGG + Intronic
945923576 2:215780593-215780615 ATCTCACAGTACTTGAAATATGG - Intergenic
946609936 2:221447288-221447310 CTCTTACAGAAAAAGAAACACGG + Intronic
948819046 2:240529253-240529275 CGCTTATAGTCATAGAAAAAGGG + Exonic
1169235648 20:3927857-3927879 CCCTTACAGTCACAGAAGTAAGG + Intronic
1173460268 20:43237643-43237665 CTCTGCCAGTAAGAGAAATGAGG + Intergenic
1176796267 21:13372862-13372884 CTGTTAGAGTAGTAGAAAGATGG - Intergenic
1176903319 21:14469752-14469774 CTCTAACAGTAATTTAAATCAGG + Intergenic
1178738835 21:35177552-35177574 CTTTACCAGTACTAGAAATATGG + Intronic
1179426667 21:41285046-41285068 CTCCTAAAGAGATAGAAATATGG + Intergenic
949606904 3:5663059-5663081 GAATTACAGTAATAAAAATATGG - Intergenic
951102130 3:18701242-18701264 GTATTACAGTAATAGAATTGAGG - Intergenic
952119458 3:30224672-30224694 ATTTTACAGTAAATGAAATACGG - Intergenic
956014312 3:64865220-64865242 CTTTTACAATAATATATATAAGG - Intergenic
956689872 3:71866009-71866031 TTCTTACTGGAATAGAATTATGG - Intergenic
957829491 3:85497396-85497418 CTCTTGCAGTAGCAGAAAGAAGG + Intronic
958664101 3:97111620-97111642 ATGTTACAATAATATAAATAAGG - Intronic
958757630 3:98270276-98270298 ATCCTGCAGAAATAGAAATATGG - Intergenic
959483534 3:106901811-106901833 CTCTTGAAGTCATAAAAATAAGG - Intergenic
962087649 3:132208735-132208757 TTCTTACAGAAATGGAGATAGGG - Intronic
962375554 3:134856050-134856072 CTCACACAGGAATACAAATAAGG + Intronic
963693812 3:148539303-148539325 TTCTTCCAGTAACAGAAAAATGG + Intergenic
965281330 3:166757875-166757897 CTATTACACTAATAGATTTAAGG - Intergenic
966705625 3:182910572-182910594 CTCTAAAAATAATAAAAATAAGG + Intronic
966897325 3:184455426-184455448 ATCTTACAGATATAGATATAGGG + Intronic
968842747 4:3019975-3019997 CACTTACACTATTGGAAATATGG + Intronic
972361422 4:38328902-38328924 CTCTTACAGAAATACACACATGG - Intergenic
972572364 4:40321919-40321941 CTCTTACAGTAATGGACTGATGG + Intergenic
972903517 4:43715360-43715382 CTCTTATAATAATGGAAACATGG + Intergenic
973136783 4:46718398-46718420 CTCTTACAATTATAATAATAGGG - Intergenic
974782502 4:66571778-66571800 CTCTTACAGTAAAATGAAAAAGG - Intergenic
975192089 4:71476513-71476535 ATTTTACAGGAATGGAAATAGGG + Intronic
975342991 4:73261730-73261752 CTCTTACAGTAAGTGCAAAAAGG - Intergenic
976153512 4:82117373-82117395 ATCTGACAGCAATAAAAATATGG - Intergenic
976946450 4:90775406-90775428 GTTTTACAGTAAAAGAGATAAGG + Intronic
976959756 4:90955724-90955746 TTGTTTCAGTAATAGAAATGAGG - Intronic
977177730 4:93836590-93836612 CTCTGAAAGAAATAGAAAGATGG + Intergenic
977215361 4:94276459-94276481 CTCTTACATTAATTGTCATAAGG - Exonic
978129623 4:105179365-105179387 ATCTTTCATTAAAAGAAATAGGG + Intronic
978401790 4:108338864-108338886 CTCTCACAGTAGTAGAATAATGG - Intergenic
978881844 4:113714163-113714185 ATCATAAACTAATAGAAATAGGG - Intronic
978970775 4:114802930-114802952 ATCTTTCAGTGATAGTAATAAGG - Intergenic
982469189 4:155766095-155766117 CTCTTTCTGTAATAAAAATATGG + Intronic
983290083 4:165790849-165790871 ATCTTACAGTAATGGATGTATGG + Intergenic
983368877 4:166833559-166833581 CACTTATAGTAATATTAATATGG + Intronic
983442062 4:167798916-167798938 TTCCTATAGTAATAGAAACAAGG - Intergenic
983504051 4:168533361-168533383 AACCTACAGTAATAGAAATTAGG + Intronic
983637728 4:169914971-169914993 ATGTTACAGTAATAAAACTAAGG - Intergenic
986966105 5:13273526-13273548 CTGCTACAATAATAGAAACAAGG - Intergenic
987081802 5:14431887-14431909 TTCTTACAGAAAAGGAAATAGGG - Intronic
987341457 5:16943141-16943163 CTATTACATTAATAGATATAGGG - Intergenic
987629908 5:20456728-20456750 CTATTACATTAAAAAAAATATGG - Intronic
987677948 5:21099223-21099245 ATCTTGCAGGAATATAAATAAGG + Intergenic
988155366 5:27442723-27442745 CTCTTAATGTAATAGAAAATTGG + Intergenic
988285207 5:29205830-29205852 TTCTTACAGGGATGGAAATAAGG + Intergenic
988834370 5:35016820-35016842 CTCTTACAGTAGTACAGAGATGG + Intronic
989299001 5:39866219-39866241 CTTTTACAGAATTAGAAAAAAGG - Intergenic
990820342 5:59832717-59832739 CTATTACTGTGAAAGAAATATGG + Intronic
992327151 5:75671591-75671613 CTCTTTCAGTAAGAGAAACTGGG + Exonic
992726735 5:79614740-79614762 CTATTACTGTAACAGAAATAAGG - Intronic
994081551 5:95712978-95713000 CACTTACAGTAATAACAAAAAGG - Intergenic
994884803 5:105546648-105546670 CTCTTTCAGAAATATAAACATGG - Intergenic
995245214 5:109927664-109927686 AGCTAACAGTAATAGTAATAGGG - Intergenic
997556131 5:134800299-134800321 CTCTTAGAGTTATAGATAAATGG + Intronic
997655746 5:135553067-135553089 TTCTTACTGTAACAGAAAGAGGG - Intergenic
1001366806 5:171149424-171149446 CTGATACAGTAAGTGAAATACGG - Intronic
1003815390 6:9834678-9834700 TTCTTACAGTAACTCAAATAAGG + Intronic
1004005444 6:11633604-11633626 ATTTTACAGAAATAGAAATAAGG - Intergenic
1005449924 6:25962636-25962658 CTTTTACAGCAATAAAAAGAAGG - Intergenic
1005657802 6:27960899-27960921 CTCTTATAAAGATAGAAATAAGG + Intergenic
1007136093 6:39523338-39523360 CTCTTTCTATAACAGAAATATGG + Intronic
1009277161 6:61697764-61697786 CTTTGACAGTTATTGAAATATGG - Intronic
1010341132 6:74754355-74754377 TTCTTACAATAATTGAAATGAGG - Intergenic
1012306933 6:97670026-97670048 CACCTTCAGAAATAGAAATATGG - Intergenic
1012790543 6:103688531-103688553 CTCCTATGGTGATAGAAATAGGG + Intergenic
1012912130 6:105130100-105130122 TTCTTAAAGTAGTAGAATTATGG - Intronic
1015542991 6:134334707-134334729 GTCTTATAGTAATAGCATTATGG - Intergenic
1015947663 6:138519829-138519851 GTATTTCAGTAATATAAATATGG - Intronic
1016129713 6:140452366-140452388 CTCTTACAGAAAATGAAAGAGGG - Intergenic
1016755705 6:147683568-147683590 CTCTTACAGTGAGAAAAAGATGG + Intronic
1017861230 6:158399148-158399170 CTTTTGAAGTAATAGAAAAAAGG + Intronic
1018132818 6:160748818-160748840 CTCTGCCAGGAAAAGAAATAAGG + Intronic
1021304951 7:19021310-19021332 CTCTTACAGTAACAGTTATGTGG - Intronic
1023509699 7:40938620-40938642 CTAATACAGTAATAGATATTGGG - Intergenic
1023703227 7:42912500-42912522 CTACTACAGTAATATGAATATGG - Intronic
1023704726 7:42929794-42929816 CTCTTAAAGGAATAAAAATGAGG - Intronic
1025153119 7:56576047-56576069 CTGTTACAGCAATGGGAATATGG - Intergenic
1025764258 7:64428092-64428114 CTGTTACAGCAATGGGAATATGG + Intergenic
1025804058 7:64812543-64812565 CTACTACAGTAATGGAAATATGG - Intronic
1025816207 7:64914601-64914623 CTGCTACAGTAATGGCAATATGG - Intronic
1026219683 7:68382889-68382911 CCCTTACAGTAATGCAAAAACGG + Intergenic
1026365055 7:69639918-69639940 CTCTTACAGTCTTAGAGATCTGG + Intronic
1028334443 7:89634455-89634477 TTATTACAGAAATAGAAAAATGG - Intergenic
1029788971 7:102822557-102822579 CTGTGACAGTAATAGAAAGTGGG - Intronic
1030655164 7:112159562-112159584 CTGTTAGAGCAAAAGAAATACGG - Intronic
1031104206 7:117519834-117519856 CTTTTATAGTAATAAAAAAATGG - Intronic
1031213080 7:118856707-118856729 CTCTTGCATTAATAGAAGTGAGG + Intergenic
1032860131 7:135869019-135869041 TTCTTCCAGTTATATAAATATGG - Intergenic
1032967177 7:137111809-137111831 CATTTACAGTGATAGAAAGAGGG - Intergenic
1034543008 7:151771123-151771145 TTCTTACAGTAGTAGAAATCAGG - Intronic
1034979241 7:155465837-155465859 CTCTTATTTTAATAAAAATACGG + Intergenic
1035545219 8:476135-476157 CTATTACATTAATAGAATGAAGG - Intergenic
1038922618 8:32101769-32101791 CCCTTATAGTTATAGAAATTAGG + Intronic
1041159253 8:55021040-55021062 CTCTGTCAGTAATTGAAAGAAGG - Intergenic
1041183684 8:55275310-55275332 ATTTTATAGTAATAGATATAAGG + Intronic
1045780643 8:105858972-105858994 CTATAACAGTAATAAAAATGAGG + Intergenic
1046604270 8:116353480-116353502 CTCATACATTAATAGAGCTAAGG - Intergenic
1048601786 8:135926171-135926193 TTCTTAGAGTCATAGATATAAGG + Intergenic
1051108267 9:13605113-13605135 CTCTAACAGAACTAGACATAAGG - Intergenic
1051133000 9:13883624-13883646 CTCTTACTGAAATAAAAACAGGG + Intergenic
1051701349 9:19827531-19827553 ATCTTAGAGTCAAAGAAATATGG - Intergenic
1051736804 9:20208591-20208613 CACATACAGTAATACAAATGTGG + Intergenic
1057452041 9:95173216-95173238 CTCCTGGAGGAATAGAAATAGGG + Intronic
1059011389 9:110465592-110465614 CTCATACAGTAATAAACATGTGG - Intronic
1059418476 9:114176467-114176489 ATTTTACAGTAATAGAAAAAAGG + Intronic
1188362099 X:29267584-29267606 TTCTTCCACTATTAGAAATAGGG - Intronic
1188918459 X:35941532-35941554 CTTTTACAGTAATACTATTAAGG - Intronic
1189131526 X:38502952-38502974 CTCTTACAGTCTAAGAAAGATGG - Intronic
1190415471 X:50176339-50176361 CTTTTACAGGACTAGAAACATGG + Intergenic
1190868819 X:54407734-54407756 TTTTTACTGTAATAGAGATAGGG - Intergenic
1191115110 X:56844354-56844376 CTCCCACAGTAATAAAAATTTGG + Intergenic
1191907908 X:66114180-66114202 CTCTGACCATACTAGAAATAAGG + Intergenic
1193681864 X:84530945-84530967 TTCTTACAAGAATAGAAACAGGG + Intergenic
1193919912 X:87412586-87412608 CTCTTAGAATGAAAGAAATATGG + Intergenic
1194065672 X:89258761-89258783 CTCTTACACCATTAGAAGTATGG - Intergenic
1196050506 X:111298891-111298913 TCCCTACAGAAATAGAAATAGGG - Exonic
1198162837 X:134024582-134024604 CCCTTAAAGTATTAGCAATATGG + Intergenic
1199193584 X:145001113-145001135 CTCTCACAGTTATAGAAGCATGG + Intergenic
1199987670 X:152964153-152964175 CTCTTACAGAGATAGGAAAAAGG - Intronic
1200423347 Y:2996781-2996803 CTATTATATTAAGAGAAATAAGG + Intergenic
1200719840 Y:6592893-6592915 CTCTTACACCATTAGAAGTATGG - Intergenic