ID: 923804165

View in Genome Browser
Species Human (GRCh38)
Location 1:237240033-237240055
Sequence CTCTTGTGCTTAAGCACTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923804165_923804167 16 Left 923804165 1:237240033-237240055 CCATTAGTGCTTAAGCACAAGAG 0: 1
1: 0
2: 1
3: 10
4: 95
Right 923804167 1:237240072-237240094 TATATAGTCTGTTGTTTTCCTGG 0: 1
1: 0
2: 2
3: 18
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923804165 Original CRISPR CTCTTGTGCTTAAGCACTAA TGG (reversed) Intronic
901369549 1:8784933-8784955 CTCTACTGCTTAAGCAACAAAGG + Intronic
902894545 1:19469992-19470014 CTCTTGTGCTCAAGCCACAATGG - Intronic
906112354 1:43332391-43332413 GTCTTGTGCTGCAGCACTGAGGG + Intergenic
908178638 1:61581461-61581483 GTCTTCTTCTTAAGCACCAAGGG + Intergenic
908481992 1:64549869-64549891 CTCTTGTGATTACTCAGTAACGG + Intronic
910005686 1:82393826-82393848 CTCTTTTGCTTAAAGACTTAAGG + Intergenic
910479861 1:87646743-87646765 CACATGTGATTAAGAACTAAAGG + Intergenic
912567607 1:110599527-110599549 CTCTTGTGCATAAGCCCAAAGGG - Intronic
917289554 1:173458499-173458521 CTTATCTGCTTAAGCTCTAAAGG - Intergenic
918125770 1:181582171-181582193 CTATTATGCTAAAGCTCTAAAGG + Intronic
920351762 1:205342688-205342710 CTCTTTTGCTAAAACACAAAGGG - Intronic
920645194 1:207798013-207798035 CTCCTATACTTAAGCAATAAGGG - Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921626943 1:217387612-217387634 CTCATGGGCTTAACCACTAAAGG + Intergenic
923284867 1:232484083-232484105 CTCTTTTGCTTATTCACTTATGG - Intronic
923804165 1:237240033-237240055 CTCTTGTGCTTAAGCACTAATGG - Intronic
1064143696 10:12810752-12810774 CTATTTTGCTCATGCACTAAAGG - Intronic
1065410836 10:25425745-25425767 CTCTTCTGCTTTAGCACTCCTGG + Intronic
1065763627 10:29006812-29006834 GTGTTGTGTTTAAGCACTGAGGG + Intergenic
1067600103 10:47590246-47590268 CTCTTCTGCTCAAGCAGAAAAGG - Intergenic
1069099830 10:64306431-64306453 CTCATTTTCTTGAGCACTAAAGG + Intergenic
1071238758 10:83680499-83680521 CTCCTGTGCTTCAGCACCAGGGG - Intergenic
1076048218 10:127312179-127312201 CTCTTCTTCTTAGGCAGTAATGG - Intronic
1077833584 11:5902569-5902591 GTCTTGGGCTTAAGGACTCAGGG + Intronic
1078104770 11:8351574-8351596 CTCTTGTGCTTTAGAAATTATGG - Intergenic
1078344482 11:10533690-10533712 CTCTTGTTTGAAAGCACTAAAGG - Intronic
1086192441 11:84095466-84095488 CCCATGTCCTTAAGGACTAATGG + Intronic
1088082430 11:105934792-105934814 CTCTTTTCCTTAAGCAATAAAGG + Intronic
1090887605 11:130892997-130893019 TCCTGGTGCTTCAGCACTAAGGG - Intronic
1092048943 12:5454421-5454443 GTCATGTGCTCAAGTACTAAGGG + Intronic
1092957825 12:13565886-13565908 CTCTTGAGCTTAATCAGGAAGGG - Intronic
1104378833 12:128289336-128289358 CCCTTGTTCTTAAAAACTAACGG - Intronic
1106211760 13:27655119-27655141 ATCTTGTGCTAAACCACTATGGG - Intronic
1108884430 13:55162576-55162598 CTCCTGTCTTTAAGCAATAATGG + Intergenic
1111104602 13:83629230-83629252 CTCTTGTGCTCAACCCCTCATGG + Intergenic
1114178823 14:20347732-20347754 CTCAGGTGTTTAACCACTAATGG - Intronic
1115246008 14:31295717-31295739 GTCTTGTTCTTCAGCCCTAAGGG - Intronic
1115614357 14:35079522-35079544 CCCATGCTCTTAAGCACTAAAGG - Intronic
1117797419 14:59408774-59408796 CGCTTTTGCTTAAGCAGAAATGG - Intergenic
1118748185 14:68789197-68789219 CTCTTGTGATTTGGCACTTAAGG + Exonic
1127040927 15:54975536-54975558 CTCTTGTGATTAAGCACGTAGGG + Intergenic
1130327134 15:82890024-82890046 CTCTGGTGCCACAGCACTAAGGG + Intronic
1135640091 16:24112050-24112072 CTTGTGCGCTTAACCACTAAGGG + Intronic
1139251135 16:65497717-65497739 CTCTTTTGCTTATGCAGTGACGG + Intergenic
1139410262 16:66752930-66752952 ATTTTGTGATTAAACACTAAAGG + Intergenic
1143242280 17:5453999-5454021 TTCATGTGATGAAGCACTAATGG - Intronic
1148941699 17:51219465-51219487 ATCTTTTGCGTTAGCACTAAAGG - Intronic
1151504615 17:74519275-74519297 CTCGTGTGCTATAGCACTAGGGG - Intergenic
1153256370 18:3175637-3175659 CTCTTGTTTTTAATAACTAAAGG - Intronic
1158836763 18:61338660-61338682 CTCTTCTTCCTAAGCAATAAGGG + Intronic
1162271238 19:9617316-9617338 CTCTTGTGTCTAAACACTCAAGG + Intronic
1162280584 19:9693965-9693987 CTCTTGTGTCTAAGCAATCAAGG + Intronic
1163224713 19:15950071-15950093 CACTTGAGCTTAAGCAAAAAGGG - Intergenic
1166594428 19:44033183-44033205 CTATTGTTCTATAGCACTAAAGG - Intergenic
1166640729 19:44493068-44493090 TTCTTGTGCGTGAGGACTAAAGG - Intronic
927614500 2:24578548-24578570 CTCTTTTCCTTAAGAGCTAATGG - Intronic
928214989 2:29353974-29353996 CTCTTGTGCTTAAGGACCAAAGG - Intronic
930354310 2:50298133-50298155 CTTTGGTGCTTTAGCACTTACGG - Intronic
930569574 2:53067948-53067970 GTCTTGTACTTAAGCATGAACGG + Intergenic
932187163 2:69708091-69708113 TGCTAGTGCTTAAGCACAAACGG + Intronic
937564463 2:123267326-123267348 CTCATGAGCTTATGCATTAAAGG + Intergenic
941442128 2:165551452-165551474 CACTTGTGATTTAGCACCAAGGG - Intronic
943462512 2:188186240-188186262 CTCTATTGCTAAAGCACTGAGGG + Intergenic
945956042 2:216086724-216086746 CTCTTCTTCTTAACCACCAATGG - Intronic
1169649551 20:7851809-7851831 CTCTTGTGCCTAGGTACCAAGGG + Intergenic
1173619343 20:44424708-44424730 CTCTTGTGCTAAGACCCTAACGG + Intronic
1180501743 22:15935996-15936018 CTCTTGTGCTGAAAAACTAACGG - Intergenic
1181362534 22:22349150-22349172 CTCTTGAGCAAAAGCACTAAGGG + Intergenic
1183143911 22:35971720-35971742 CTCTTGAGCTCCAGCAGTAAGGG + Intronic
950024676 3:9811979-9812001 CTCTTTTGCTTAACCACTATGGG + Intronic
951333930 3:21398748-21398770 CACTTGTGCTTAAGCCCTGGGGG - Intergenic
967363578 3:188660000-188660022 CTCTCGTGCTTACGCTTTAAAGG - Intronic
968384865 4:126667-126689 GTCTTCTACTTAAGAACTAATGG + Intronic
968393851 4:214829-214851 GTCTTGTACTTGAGTACTAACGG + Intergenic
972318726 4:37952321-37952343 ATCTTGTGCTAAATCACTGATGG + Intronic
974980426 4:68949696-68949718 CACCTGTGCGTAAGCACTTATGG + Intronic
976041814 4:80895431-80895453 ATCTTGTGCTTATTTACTAAAGG - Intronic
982322562 4:154094735-154094757 CTCTTGTGTTTAGGACCTAATGG + Intergenic
982509028 4:156257469-156257491 TTCTTCTTCTTAAGCACTTACGG - Intergenic
982585090 4:157225759-157225781 CGCTTGTGTTTAAGAACTACTGG - Intronic
982678907 4:158406943-158406965 CTCCTCTGATTAAGCTCTAATGG - Intronic
984315459 4:178124511-178124533 ATCATGTTCTTAAGCAGTAAGGG + Intergenic
984674644 4:182533051-182533073 CTTTAGTGCTCAAGCACTTAGGG - Intronic
988303160 5:29460520-29460542 CTATTGTGATTCAGCCCTAAAGG + Intergenic
990488125 5:56278977-56278999 ATATTGGGCTTAAGCACAAATGG + Intergenic
1008256906 6:49313297-49313319 CACCTGTGCTTCAGCAATAAAGG + Intergenic
1027819290 7:83023580-83023602 CTTTTGTGCTAAAGCATTTAGGG - Intronic
1031441338 7:121798319-121798341 CTGTTGTGCTTAAGCACAATGGG + Intergenic
1032327515 7:130944863-130944885 CTCTTGTGTTTAAGAATTAAAGG - Intergenic
1032357909 7:131227273-131227295 GTCTTGTGCTGGAGAACTAAAGG - Intronic
1035450228 7:158973239-158973261 CTCTTCTGCTAAAGCCCTAGCGG + Intergenic
1037744335 8:21630924-21630946 CTTGTGTCCTTAAGCACTCATGG - Intergenic
1038795495 8:30705810-30705832 CTCCTGTGCTTAAGGACTGCAGG + Intronic
1044555610 8:93558882-93558904 CTCATGTGCTCAAACTCTAATGG - Intergenic
1052261058 9:26516729-26516751 CTATTGTTGTGAAGCACTAAAGG + Intergenic
1055350721 9:75384276-75384298 CCCATGTGCTTAAGCACATATGG + Intergenic
1060845158 9:126831112-126831134 CTCTGGTCTTTCAGCACTAAAGG - Intronic
1190257979 X:48778477-48778499 CTCTAATGGTTATGCACTAATGG - Intergenic
1191998275 X:67120513-67120535 CTCTTGGCCTTAGGCACTCATGG + Intergenic
1192078135 X:68021068-68021090 CTCTGGTTCTTAAGCACCAGTGG + Intergenic
1193421267 X:81284910-81284932 CTCCTGAGCTTAAGCAATGATGG - Intronic
1199502210 X:148519560-148519582 TTCTTGTGCTTATGCATTAAGGG + Intronic
1200952122 Y:8908459-8908481 CTCTTGTGCTTGAAAACTAGGGG - Intergenic
1202160892 Y:21935177-21935199 CTCTTGTGCTTGAAAACTAGGGG + Intergenic
1202230464 Y:22651196-22651218 CTCTTGTGCTTGAAAACTAGGGG - Intergenic
1202312693 Y:23544969-23544991 CTCTTGTGCTTGAAAACTAGGGG + Intergenic
1202558109 Y:26125625-26125647 CTCTTGTGCTTGAAAACTAGGGG - Intergenic