ID: 923805783

View in Genome Browser
Species Human (GRCh38)
Location 1:237256409-237256431
Sequence TTTCTATAATCACCATACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923805783 Original CRISPR TTTCTATAATCACCATACAC AGG (reversed) Intronic
905833931 1:41100232-41100254 TCTCTTTTATCACCATACCCGGG - Intronic
907557741 1:55359352-55359374 TTTTTATAAAAACCCTACACTGG - Intergenic
907762205 1:57372219-57372241 TCTCTATAGACACCATAAACTGG + Intronic
907872114 1:58452981-58453003 TTTTCATAATTACCAAACACTGG + Intronic
908090474 1:60680268-60680290 CTTCTATAATCCCCATACGGTGG + Intergenic
908963928 1:69735122-69735144 TTTCTATAACCACCATTATCAGG + Intronic
909155857 1:72075751-72075773 ATTCTATATTCAACATACCCAGG - Intronic
909507633 1:76411765-76411787 TTTCTATAATCCCCACGCCCTGG - Intronic
913442666 1:118915210-118915232 TTTCTAGAATCACCTTGCATTGG - Intronic
916895236 1:169155415-169155437 TTTTTGTTATCACCATAAACAGG - Intronic
917964631 1:180170584-180170606 TTTCTTTCATCACTTTACACAGG - Intronic
918025249 1:180737872-180737894 TTTTCATAATCACCAAAAACTGG - Intronic
918957457 1:191228099-191228121 TTTGTATCATCACCATACCTAGG + Intergenic
921723626 1:218500847-218500869 TTACTATCATCACCATTTACAGG - Intergenic
923805783 1:237256409-237256431 TTTCTATAATCACCATACACAGG - Intronic
924040306 1:239978190-239978212 TTTGCATGATCACCATTCACAGG + Intergenic
924852072 1:247840659-247840681 TGTGTGTAATCACCATCCACTGG + Intergenic
1063279018 10:4604258-4604280 TTTCTATAAACACCTGAGACTGG + Intergenic
1065421948 10:25554820-25554842 TTTTTATAATCACCATATACTGG - Intronic
1065636194 10:27737400-27737422 ATCCCATAATCACCATACAGTGG + Intronic
1066078203 10:31902413-31902435 TGCCTATAATCCCAATACACTGG + Intronic
1067229204 10:44395205-44395227 TTTCTGTAATCACCACCCCCTGG + Intergenic
1068726058 10:60304847-60304869 TGTATACAATCACCATGCACAGG + Intronic
1070266219 10:74905753-74905775 TTTTTATTATCACCCTACACCGG - Intronic
1081614222 11:44580990-44581012 TCTCTCTAATCACCCTACTCAGG + Intronic
1083721222 11:64604523-64604545 TTTCTAGAATGACCCTAAACAGG - Intergenic
1084868186 11:72077275-72077297 TTTCTTAAATCACTATATACTGG - Intronic
1085918596 11:80923750-80923772 TTTCTATATTCACTGTCCACCGG + Intergenic
1087194982 11:95296319-95296341 TTTTTGTTATCACCATGCACTGG + Intergenic
1088008913 11:104975067-104975089 ATTCTAAAGTCACGATACACAGG + Intergenic
1089074110 11:115723823-115723845 TATCCATAATCACCAAAAACTGG - Intergenic
1089673187 11:120071382-120071404 TTTCTTTAATCACTATTCCCTGG - Intergenic
1090102725 11:123817379-123817401 TTTCTATATTCACCGTCCTCTGG - Intergenic
1090516523 11:127434022-127434044 TGTCTATAATCTCCATTCATAGG + Intergenic
1092584199 12:9879460-9879482 TTTCTTGAATGACTATACACTGG + Intergenic
1094697372 12:32833757-32833779 CTTCTTTAACCAGCATACACAGG + Intronic
1095164491 12:38955778-38955800 TTCTTATAATTTCCATACACTGG - Intergenic
1095482789 12:42652984-42653006 TTTTTTTAATCACCAGACCCTGG - Intergenic
1095860672 12:46914356-46914378 TTTCTATCAACAGCATACAAGGG - Intergenic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1097576882 12:61405499-61405521 TATTTATAATCACCAAAAACTGG + Intergenic
1100406539 12:94277055-94277077 TCTTTATAAACACCATAAACTGG + Intronic
1100666035 12:96754677-96754699 CTTCTATAATCACTATAGAAAGG - Intronic
1101389296 12:104285930-104285952 TGTCAATAATCACCTTACAGGGG + Intronic
1102783175 12:115583249-115583271 TGTCTCTAAGCACCACACACAGG + Intergenic
1103004597 12:117410605-117410627 TTTTTCTTATCACCATGCACTGG + Intronic
1107101100 13:36593532-36593554 TTCCTATTATCATCATAAACAGG - Intergenic
1107452853 13:40527190-40527212 TATTCATAATCACCATAAACGGG + Intergenic
1108468026 13:50738403-50738425 TTTTTATTATCACCATGTACTGG - Intronic
1109341070 13:61059770-61059792 TTTTTATTCTCACCATGCACAGG - Intergenic
1110812515 13:79826563-79826585 TTACTTGAATAACCATACACAGG + Intergenic
1111044387 13:82795827-82795849 TTTCTAGGATTACCATACATTGG - Intergenic
1111135380 13:84035603-84035625 TTTCTAGAATCATCAAGCACAGG - Intergenic
1111143598 13:84154225-84154247 TGCCTATAAGCACCATATACAGG - Intergenic
1111182088 13:84682835-84682857 TTTTTGTTATCACCATACACTGG - Intergenic
1111523349 13:89434181-89434203 TTTCTATCTTCACCAAACATGGG - Intergenic
1114158511 14:20134908-20134930 GTTATATAATCACCAAACAAAGG + Intergenic
1115063809 14:29228602-29228624 TTTCTATAATTTCAATACACAGG + Intergenic
1116643340 14:47494336-47494358 ATTCTATAATCACCATAGTTTGG + Intronic
1118197848 14:63644633-63644655 TTTCTATTTTCAGCAGACACTGG + Intergenic
1120580579 14:86243032-86243054 TATTTATTATCACCAAACACTGG + Intergenic
1121227584 14:92332803-92332825 TTTCTGTACTTACCACACACAGG - Intronic
1121364816 14:93299545-93299567 TTTCTAGAATCACCATTCTGGGG + Intronic
1121755351 14:96397999-96398021 TTTCTAGAATCATCATTCACTGG + Intronic
1122057897 14:99117522-99117544 TTTTTATGATCACTATGCACTGG - Intergenic
1124044030 15:26131363-26131385 TTTCTATAATCATCTTCCAGAGG - Intergenic
1124079988 15:26484457-26484479 TATCTATAATCACCAAAGATTGG + Intergenic
1124472334 15:29999360-29999382 CTTCCATAAGCACCATTCACAGG - Intergenic
1126043450 15:44616058-44616080 TTTCTATAAACTCCATATACAGG - Intronic
1126862651 15:52902228-52902250 TATTTATAATTACCATAAACTGG - Intergenic
1128837038 15:70817479-70817501 TTGCTATAAACACAAGACACAGG - Intergenic
1130450618 15:84048036-84048058 TATCTATAATCACCCCAAACTGG - Intergenic
1135171723 16:20190044-20190066 TTTCTCTTTTCTCCATACACGGG - Intergenic
1135873619 16:26176249-26176271 TTTCCATAACCTCCATACCCTGG + Intergenic
1137869040 16:51931866-51931888 TTTCTCTAATTAACAGACACAGG - Intergenic
1138932970 16:61683954-61683976 TTTCTAGAATTACCAAACATGGG - Intronic
1138993350 16:62418260-62418282 TTTCTATTTGGACCATACACTGG + Intergenic
1144193706 17:12870486-12870508 TTTCTTTAAGGACAATACACAGG - Intronic
1144408777 17:14978634-14978656 ATCCTATAATCACCAAAAACTGG - Intergenic
1146960485 17:36971645-36971667 TATTTATAATCACCAAAAACTGG + Intronic
1147736784 17:42644032-42644054 GTGATATAATCACCATGCACTGG - Intergenic
1148818745 17:50347969-50347991 TCTTTATAATCACCTAACACGGG - Intronic
1203172841 17_GL000205v2_random:166613-166635 TATAAATAATCAACATACACAGG + Intergenic
1153490432 18:5641347-5641369 TTGCTATAAACACCTGACACTGG - Intergenic
1154405110 18:14083861-14083883 TTTCTTTAATCCTCATCCACTGG + Intronic
1154504670 18:15023908-15023930 TTCTTATAATCAACATACATGGG - Intergenic
1155590683 18:27423870-27423892 TTTCAATACTGACCATACAATGG + Intergenic
1158027631 18:52920745-52920767 TGTTTATAATCACCAAAAACTGG + Intronic
1159378181 18:67621315-67621337 ATTCCATACTCACCCTACACAGG - Intergenic
1159689861 18:71473059-71473081 TTTGTGCAATGACCATACACAGG - Intergenic
1160122010 18:76139166-76139188 TTTGTGTAACCACCATACCCCGG + Intergenic
1165186073 19:34022888-34022910 TATCTCCAATCACCATACACAGG + Intergenic
928558698 2:32454904-32454926 TTTCTAGAATCACCATATAAAGG - Intronic
930403140 2:50917166-50917188 TTTGTATATGCACCAAACACAGG + Intronic
932053531 2:68422120-68422142 TTTCTTCAATCACCACACAGTGG - Intergenic
932936652 2:76110805-76110827 TTTCTATAATTACATTACACAGG - Intergenic
933510508 2:83235005-83235027 TTTCTATAATCTCCTAGCACTGG + Intergenic
935452412 2:103224684-103224706 TTTATATAATCCCCATAGAAAGG - Intergenic
935821458 2:106896898-106896920 TTTCTATAATGAGCACACATGGG - Intergenic
935948739 2:108309683-108309705 TTTTTATTATTACCATGCACTGG + Exonic
937582486 2:123503816-123503838 ATTCTATAATTACCACACATGGG + Intergenic
937610134 2:123851144-123851166 TTTCTAATAACACTATACACAGG - Intergenic
938503859 2:131854118-131854140 TTCTTATAATCAACATACATGGG - Intergenic
939291675 2:140203854-140203876 TCTCTATAATCACATTACAAGGG + Intergenic
940343681 2:152606807-152606829 TTTCTATACTCACCTTAAATGGG + Intronic
942207075 2:173629848-173629870 TGTCTATAATGACCAGAAACAGG - Intergenic
942521030 2:176804408-176804430 TATATATAATCACTATAAACAGG + Intergenic
943542353 2:189232361-189232383 CATCTATAATCACAACACACAGG + Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
944681915 2:202084932-202084954 TTTCCATCATGACTATACACAGG + Intronic
946704508 2:222445119-222445141 TTACTATCTTCACCTTACACAGG - Intronic
947397892 2:229704421-229704443 TATTCATAATCACCAGACACTGG + Intronic
1169965298 20:11210840-11210862 TTTCTAAGATCAGCATCCACTGG - Intergenic
1169985378 20:11437559-11437581 TTTCTAACATCCCCATCCACAGG + Intergenic
1170498004 20:16945619-16945641 TTTCTCCATTCACCAGACACTGG + Intergenic
1171260985 20:23734524-23734546 TATCCATAAGCACCACACACTGG - Intergenic
1171270104 20:23810366-23810388 TATCCATAAGCACCACACACTGG - Intergenic
1173136858 20:40446507-40446529 TTTCTATAAGCATCAGACATAGG + Intergenic
1174747630 20:53079508-53079530 TTTCTGTATTCCCAATACACAGG - Intronic
1175973301 20:62698091-62698113 TTTCTAAAAATAGCATACACAGG - Intergenic
1176328836 21:5528394-5528416 TATAAATAATCAACATACACAGG + Intergenic
1176398921 21:6292557-6292579 TATAAATAATCAACATACACAGG - Intergenic
1176438236 21:6696547-6696569 TATAAATAATCAACATACACAGG + Intergenic
1176462498 21:7023617-7023639 TATAAATAATCAACATACACAGG + Intergenic
1176486059 21:7405395-7405417 TATAAATAATCAACATACACAGG + Intergenic
1177598615 21:23281077-23281099 TTTCTATAATTACTATAAGCTGG + Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1184888204 22:47360476-47360498 TATTTATAATCACCAAAAACTGG - Intergenic
951359619 3:21709862-21709884 TCTTTATAATCACCAAAAACTGG + Intronic
954845941 3:53556205-53556227 TTTTTATAATCACCAGAAACTGG - Intronic
955120315 3:56051621-56051643 CTTCCATCAACACCATACACTGG + Intronic
956846855 3:73191858-73191880 TTTTCATAATCACCATACACTGG - Intergenic
957025763 3:75179901-75179923 ATTCTATAATAACCATTCAGAGG - Intergenic
958974270 3:100648473-100648495 TTTCTATAAAAGCAATACACAGG + Intronic
959441108 3:106376564-106376586 TATCTAAAACCACCATAGACAGG + Intergenic
960215291 3:115026764-115026786 TTTATTTAATCAATATACACAGG - Intronic
961341799 3:126228408-126228430 TTTCTATGATCACAATGGACTGG + Intergenic
962012538 3:131406545-131406567 TTTTTATTATCACCAGACATTGG + Intergenic
962657221 3:137560006-137560028 TATTTATAATCACCAAAAACTGG + Intergenic
963348329 3:144123144-144123166 TTTGCATAATTACCATGCACAGG - Intergenic
963489674 3:145983795-145983817 TACCCATAATCACCATATACTGG + Intergenic
963685286 3:148425748-148425770 TTTTAATGATCACCATTCACTGG - Intergenic
964446973 3:156769282-156769304 TGTCTATAATAGCAATACACTGG + Intergenic
969881768 4:10180217-10180239 TATCTATATCCACCCTACACTGG - Intergenic
971094600 4:23386592-23386614 TTTTTTTATTTACCATACACTGG + Intergenic
971994184 4:33942917-33942939 TTTCAATAATAAACATACAAAGG + Intergenic
972560573 4:40224579-40224601 TTTTTATTATCACCATGCGCTGG + Intronic
972938605 4:44169211-44169233 TTTTTATTATCACTATGCACTGG + Intergenic
974313658 4:60247678-60247700 TTTGTATAATCAACTTTCACAGG + Intergenic
978505529 4:109452346-109452368 TTTTTATAACTACCAAACACTGG - Intronic
978832215 4:113101963-113101985 TCTCTATCCTCACCATACACCGG - Intronic
979053324 4:115964497-115964519 TTTATATAATGACCATCTACTGG + Intergenic
980249290 4:130293376-130293398 TTTTTATTATCATAATACACTGG + Intergenic
980897830 4:138876667-138876689 TTTTTATTATCATCATGCACAGG + Intergenic
981214951 4:142153482-142153504 TTTGTATATTCATTATACACAGG + Intronic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
981892967 4:149761038-149761060 TTTCTAAAATCACAATATAAAGG + Intergenic
982929974 4:161392483-161392505 TTTCTATAATCTCAGCACACTGG - Intronic
985027227 4:185749939-185749961 CATCTATAAACACCAAACACTGG + Intronic
986971284 5:13340054-13340076 TTTCTAAAATCATCATACATGGG - Intergenic
987245034 5:16040204-16040226 TTCCAATAATCACCATGCAGAGG + Intergenic
987245559 5:16044788-16044810 TTCCAATAATCACCATACAGAGG + Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
990325909 5:54675136-54675158 TTTCTATATTCAGCATGCATTGG + Intergenic
991734963 5:69623374-69623396 TTTCTCTAAACACCCTCCACAGG - Intergenic
991780015 5:70123344-70123366 TTTCTCTAAACACCCTCCACAGG + Intergenic
991811397 5:70478509-70478531 TTTCTCTAAACACCCTCCACAGG - Intergenic
991859302 5:70998774-70998796 TTTCTCTAAACACCCTCCACAGG + Exonic
991872462 5:71123667-71123689 TTTCTCTAAACACCCTCCACAGG + Intergenic
992416921 5:76560451-76560473 TTTCTATAAACAAGTTACACTGG - Intronic
993437061 5:87910543-87910565 TTTCTATTTTTACTATACACTGG + Intergenic
993860451 5:93130364-93130386 TTTCTATAATTGCAGTACACTGG - Intergenic
993961073 5:94296904-94296926 ATTTTACTATCACCATACACTGG + Intronic
996700427 5:126445373-126445395 TTTTAATAATCGCCATTCACTGG + Intronic
998340024 5:141409189-141409211 TTTCTATGATTACTTTACACTGG - Exonic
999055872 5:148575631-148575653 TTTCTATAATTGCAAAACACTGG + Intronic
999100994 5:149026200-149026222 TTTCTATAACCACCTGTCACAGG - Intronic
1001456514 5:171865411-171865433 TTTTTATAATCACTAAAAACTGG + Intronic
1002711965 5:181200696-181200718 TTTCCATTAACAGCATACACCGG + Intronic
1005178574 6:23076586-23076608 TTACTATAGTCACCGTACAATGG - Intergenic
1008020225 6:46568083-46568105 TTTGTATAATCAACTTTCACAGG + Intronic
1009484886 6:64208204-64208226 GTTATATAATCCCCACACACAGG - Intronic
1011322086 6:86106781-86106803 ATTGTATAATTACCATATACTGG + Intergenic
1011524365 6:88247201-88247223 TTTTTAAAATCCCCATACCCAGG - Intergenic
1013684861 6:112567724-112567746 TTTAAATAATCACCATACAATGG + Intergenic
1015855567 6:137621101-137621123 TATCTATAATCACCAAAAACTGG + Intergenic
1017486889 6:154911345-154911367 TTTCTGTACTCACATTACACAGG - Intronic
1020063935 7:5173187-5173209 TGTCAATAATAACCAAACACTGG - Intergenic
1020218637 7:6216327-6216349 TTTATATAATTACCATCTACTGG - Intronic
1021020315 7:15590098-15590120 TGTTTATAATCACCAAAAACTGG + Intergenic
1023963263 7:44945575-44945597 TATTCATAATCACCAAACACTGG + Intergenic
1028501681 7:91526291-91526313 TTACTATGACCACCATACAGAGG - Intergenic
1028635300 7:92982096-92982118 TATTTATAATCACAAAACACTGG - Intergenic
1031624142 7:123972783-123972805 CTTCTATAATCACGATACTTTGG - Intergenic
1032297806 7:130658111-130658133 TGTTTATAATCACCAAAAACTGG + Intronic
1035984824 8:4415685-4415707 TTTATTTAATCAGCATTCACGGG - Intronic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1037230104 8:16647960-16647982 TTTTAATAATCGCCATTCACTGG + Intergenic
1039142430 8:34405026-34405048 TTTATATAATGACCACAAACAGG - Intergenic
1039196540 8:35038408-35038430 TATTCATAATCACCAAACACAGG + Intergenic
1041618171 8:59932634-59932656 TTTTTATTATCATCATGCACTGG - Intergenic
1041675908 8:60539476-60539498 TTTCAATCAGCATCATACACAGG + Intronic
1042492246 8:69412750-69412772 ATCCTCTAATCACCATCCACAGG - Intergenic
1042686209 8:71443602-71443624 GTGCTATAATGACTATACACAGG + Intronic
1042888334 8:73577567-73577589 TTTCCATAATGAACATATACTGG - Intronic
1043015220 8:74931260-74931282 TATTCATAATCACCAAACACTGG - Intergenic
1043337746 8:79197856-79197878 TTTCTATACATCCCATACACTGG + Intergenic
1044368483 8:91378689-91378711 TCTCTCTCATGACCATACACTGG + Intronic
1045116683 8:98990381-98990403 TTTCTGTTGTCAGCATACACTGG - Intergenic
1051873724 9:21768666-21768688 TTTTTATAACAACCATACAAGGG + Intergenic
1055639342 9:78307467-78307489 TTTTTATTATCACCAGGCACTGG + Intronic
1057133810 9:92672494-92672516 TTTTTATCATCACCATATAATGG - Intergenic
1203433274 Un_GL000195v1:112066-112088 TATAAATAATCAACATACACAGG - Intergenic
1186039837 X:5463691-5463713 TATCTAAAATCACAATACCCAGG + Intergenic
1186367748 X:8913151-8913173 TTTATATTATCATCATGCACTGG - Intergenic
1187648188 X:21373449-21373471 TTTCTTCAAAAACCATACACAGG - Intergenic
1188326824 X:28814669-28814691 TTTCAATAATCACAATAAATGGG - Intronic
1190384296 X:49869616-49869638 CTCCTATATTCACCATAAACTGG + Intergenic
1190493514 X:51005580-51005602 TTTCTATTATCTGCAGACACCGG - Intergenic
1190553456 X:51609601-51609623 TTTATATAAGAACCATACAGAGG + Intergenic
1190942284 X:55053625-55053647 CTTGTATAATCAGCATACAGAGG + Intergenic
1191010669 X:55754512-55754534 TTTCTAAAATCACCAAGCATTGG - Intronic
1192387613 X:70688351-70688373 TATTGATAATCACCAAACACAGG + Intronic
1193654224 X:84179394-84179416 TATTCATAATCACCAAACACTGG + Intronic
1194204278 X:90993859-90993881 TTTCTCTAATGACCATAAACTGG - Intergenic
1194222861 X:91217110-91217132 TTTCTCTAATGACCATAAACTGG + Intergenic
1195921473 X:109988248-109988270 TTTCTAGAATCACCAGAAAATGG + Intergenic
1197267540 X:124391470-124391492 TTTCTATTATTCCCAGACACAGG + Intronic
1199398562 X:147369546-147369568 TGTTTATAATCAGCAAACACTGG + Intergenic
1199931659 X:152529841-152529863 TTTCTATAACCAGCATACCCTGG - Intergenic
1200299037 X:154953847-154953869 TTTCTTTATTCACCACCCACTGG + Intronic
1200559340 Y:4680566-4680588 TTTCTCTAATGACCATAAACTGG + Intergenic
1201468113 Y:14307275-14307297 TGTCTATAATCTCAATACTCTGG - Intergenic