ID: 923809356

View in Genome Browser
Species Human (GRCh38)
Location 1:237295293-237295315
Sequence CAGGAAAGTCAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1051
Summary {0: 1, 1: 0, 2: 4, 3: 94, 4: 952}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923809352_923809356 11 Left 923809352 1:237295259-237295281 CCGTACTTCAGTGTTTGGAAAAA 0: 1
1: 0
2: 4
3: 29
4: 326
Right 923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG 0: 1
1: 0
2: 4
3: 94
4: 952

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923809356 Original CRISPR CAGGAAAGTCAGAAGGAGGA AGG Intronic
900892318 1:5458402-5458424 AAGGAAAGAAAGAAGGAGGGAGG - Intergenic
901329684 1:8396176-8396198 CAGGAAAGTGGGAGGGGGGAAGG + Intronic
901396042 1:8982341-8982363 CAGAAAAATCATAAGGAGGGGGG + Intergenic
901681534 1:10915733-10915755 CAGGTGGGTCAGAAGCAGGAGGG + Intergenic
902196662 1:14803460-14803482 CATCAGGGTCAGAAGGAGGATGG - Intronic
902868765 1:19299489-19299511 TATGAAAGACTGAAGGAGGAGGG - Intergenic
903331723 1:22600093-22600115 GAGGAAGGAGAGAAGGAGGAAGG + Intronic
903331766 1:22600238-22600260 AAGGAAGGACAGAAGGAGGAAGG + Intronic
903687486 1:25142537-25142559 CTGGAAAGGCTGGAGGAGGAAGG + Intergenic
903799465 1:25955736-25955758 GAGGGAAGGAAGAAGGAGGAAGG + Intergenic
903844756 1:26272297-26272319 CAGGAGAGTCAGTGGGAGGAAGG + Intronic
904118093 1:28176939-28176961 CATGAGAGTGAGAAAGAGGAGGG + Exonic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
905068114 1:35201099-35201121 CTGGAAAATAGGAAGGAGGAAGG - Intergenic
905119797 1:35672861-35672883 CAGGATCATCAGAAGGAGGTGGG - Intergenic
905215812 1:36406684-36406706 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905250652 1:36646203-36646225 CAGGAAGGTCAGCATGTGGAGGG - Intergenic
905257366 1:36693465-36693487 GAGGAGAGACAAAAGGAGGAAGG + Intergenic
905343534 1:37295628-37295650 CAGGAGAGTCAGGATGAGTACGG + Intergenic
905794355 1:40807274-40807296 CTGGAGAGTCACAAGGCGGAAGG + Intronic
906794968 1:48689480-48689502 GAAGAAGGACAGAAGGAGGAAGG - Intronic
906860334 1:49352526-49352548 CTGGAAGGCCAGAAGGAGGGGGG - Intronic
907039080 1:51241792-51241814 CAGGAAAGGCTGAAGAAGGGAGG + Intronic
907264693 1:53250467-53250489 GAGGAAGGAAAGAAGGAGGAAGG + Intronic
907454413 1:54565971-54565993 CAGGAAGGTAGGAAGGAGGGAGG - Intronic
907669873 1:56464963-56464985 CAGGAAGGTACAAAGGAGGAAGG + Intergenic
907907781 1:58799912-58799934 CAGGAAAGAAGGAAGGAAGAAGG - Intergenic
908151871 1:61310787-61310809 CAGGAAATTCAGAGGAAGGAAGG - Intronic
908185533 1:61649322-61649344 CTGGAAAATCATTAGGAGGAAGG - Intergenic
908424373 1:63991570-63991592 AAGGAAAGACAGAAAGAGGCAGG + Intronic
908884541 1:68773311-68773333 CAGGAGAGTGATGAGGAGGATGG - Intergenic
909005056 1:70265911-70265933 AAGGAAAGAGAGAGGGAGGAAGG + Intronic
909339141 1:74511996-74512018 AAGGAAAATCGGAAGGAAGAGGG + Intronic
909342861 1:74551087-74551109 GAGGAAAGTCAGAGTGAGAAGGG - Intergenic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
910813555 1:91263943-91263965 TAGGTAAATCATAAGGAGGAAGG - Intronic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
910964445 1:92794171-92794193 AAGGAAGGAGAGAAGGAGGAAGG + Intergenic
911167919 1:94741547-94741569 CAGGAAAGGCAGAAGTTAGAAGG + Intergenic
911434608 1:97840695-97840717 CATGAAAGGCAGAAGCATGAGGG + Intronic
912510533 1:110186911-110186933 CCAGAAAGTGAGTAGGAGGAAGG + Intronic
912538414 1:110394055-110394077 CAACAAAGGCAAAAGGAGGATGG - Intergenic
913688639 1:121257518-121257540 CAGGACAGGCAGAAAGATGATGG - Intronic
913703045 1:121392294-121392316 AAGAAAAGTAAAAAGGAGGAGGG - Exonic
913705641 1:121419432-121419454 AAGGAAAGAAAAAAGGAGGAAGG - Intergenic
914044643 1:144080533-144080555 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
914133467 1:144880153-144880175 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
914148960 1:145022758-145022780 CAGGACAGGCAGAAAGATGATGG + Intronic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
914830509 1:151167423-151167445 CGGGAAAGCCAGAGGTAGGAAGG + Intronic
914980892 1:152413419-152413441 CTGGAAAGCCAGAGAGAGGATGG + Intronic
915088982 1:153408509-153408531 CATGAAAGTGAGGAGGAGAATGG + Intergenic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
915662501 1:157415878-157415900 AAGGAGAGTCAGACGGAGGCAGG - Intergenic
915681451 1:157585644-157585666 CAGGAAACTCACAAGAAGCAGGG - Intronic
916348371 1:163820478-163820500 CAGATAAGCCAGAGGGAGGAAGG + Intergenic
916893458 1:169136622-169136644 CATGAATGGCAGAAGAAGGAGGG - Intronic
917198504 1:172491814-172491836 GAGGAAAGTGAAAAGGAGAAGGG - Intergenic
917254863 1:173103599-173103621 TGGGGAAGTCAGAAGGGGGATGG + Intergenic
917306076 1:173626936-173626958 AAGGAAAGAAAGAGGGAGGAGGG + Intronic
917562095 1:176168820-176168842 AAGGGAAGTCAGGAGGAAGAGGG + Intronic
918315513 1:183319484-183319506 CAGGAGAGTCACAAGCAGGCTGG + Intronic
918344547 1:183595208-183595230 CAGGAAACCCTGAAGGAGGCAGG + Intronic
918373106 1:183881493-183881515 GAAGAAAGTCAGAAAGAGGCTGG + Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918625507 1:186652354-186652376 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
918895385 1:190336894-190336916 AGGTAAAGTCAGAAGAAGGAAGG - Intronic
919936291 1:202252850-202252872 CTTGAAAGTCAGAGGGAAGAAGG + Intronic
920080980 1:203372797-203372819 TAGGAAAGTAAGAAAGAGGCAGG + Intergenic
920110500 1:203583857-203583879 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920110526 1:203583962-203583984 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920475963 1:206276019-206276041 CAGGACAGGCAGAAAGATGATGG - Intronic
920603576 1:207355358-207355380 GAGGAAAGAGAGAATGAGGATGG + Intronic
920693176 1:208162208-208162230 CAGGAAGGGCAGAAGGCTGAGGG + Intronic
920717528 1:208354701-208354723 GAGGAGAGTGAGAAGGAGGGAGG + Intergenic
921214397 1:212924820-212924842 GAGGGAAGTCACAAGGATGAAGG - Intergenic
921382539 1:214539655-214539677 AAGGAAGGGAAGAAGGAGGAGGG + Intronic
921392861 1:214634486-214634508 GAGGAAAGTCAGACTGAGAAAGG - Intronic
921598744 1:217084155-217084177 CAGGAAAGAAAGAGGAAGGAAGG + Intronic
921669984 1:217914572-217914594 CAGCAAAGTGAGATGGAGAAGGG - Intergenic
922321047 1:224487385-224487407 ACAGAAAGACAGAAGGAGGAAGG - Intronic
922664387 1:227456188-227456210 TTGGAAATTCTGAAGGAGGATGG - Intergenic
922822322 1:228493140-228493162 CAGGAGGCTGAGAAGGAGGAGGG + Exonic
923022505 1:230175648-230175670 GAGGACAGTGAGGAGGAGGAGGG - Intronic
923388185 1:233486680-233486702 CTTGAAAATCAGAAGGAAGATGG - Intergenic
923800663 1:237205561-237205583 CAGAAAGGTCAGAGGCAGGATGG + Intronic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
923854206 1:237828523-237828545 CATGAATGTGGGAAGGAGGAGGG + Intronic
924298729 1:242614911-242614933 AAGGAAAGTAGGAAGGAGGGAGG - Intergenic
924539207 1:244965422-244965444 CAGGACAGTGAGAGGGAGGGAGG - Intergenic
924660034 1:246007511-246007533 AAGAAAAGGCAGAAGGAGGCCGG + Intronic
1062773404 10:123654-123676 GAGGAAGGACGGAAGGAGGAAGG + Intergenic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063113919 10:3060008-3060030 AAGGAAAGTGAGAAGAAGGGAGG + Intergenic
1063197835 10:3759675-3759697 CAGGAAAGGAAGAAAAAGGAAGG + Intergenic
1063373253 10:5535592-5535614 CAGGAAACTCCAAAGAAGGAAGG + Intergenic
1063717736 10:8545266-8545288 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1063907041 10:10791947-10791969 AAGGAAGGAGAGAAGGAGGAAGG + Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064133809 10:12732911-12732933 GAGGAAACTGAGAAGGAGGGAGG - Intronic
1064247696 10:13682376-13682398 CAGGAAGCTCAGGAGGAGAAGGG + Intronic
1064880258 10:20044158-20044180 AAGGAAAGAAAGAAAGAGGAAGG - Intronic
1065263833 10:23954616-23954638 CAGGAAAGAAGGAAGGAGGGAGG + Intronic
1065698434 10:28401740-28401762 CATGAGAGTCAGAACCAGGATGG + Intergenic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1066632430 10:37470093-37470115 GAAGGAAGTCAGAAGGAGGTTGG + Intergenic
1066965643 10:42262379-42262401 CCGGAAAGTGATAAGGAGAATGG - Intergenic
1067127483 10:43532066-43532088 CATGAAAGTGACAAGGAGAATGG - Intergenic
1067163020 10:43842965-43842987 GAGGAAAGAAGGAAGGAGGAAGG + Intergenic
1067349378 10:45462240-45462262 GAGAAAGGTCAGAATGAGGAGGG + Intronic
1067662530 10:48247156-48247178 GAGGAAAGTGTGCAGGAGGAAGG + Intronic
1067842025 10:49688640-49688662 GAGGATAGGCAGAAGCAGGAGGG - Intronic
1068416963 10:56735304-56735326 AAGGAAAGACAGAAGAAGGCAGG - Intergenic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1068616999 10:59129809-59129831 CAGGAAAGCCACAAGTTGGAAGG + Intergenic
1068900213 10:62259879-62259901 CAGGTAGGTGAGCAGGAGGAAGG - Intronic
1069041768 10:63703317-63703339 GATGAAAGTCAGAAAGAGAAGGG - Intergenic
1069060968 10:63894139-63894161 AAGGAAAGAGAGGAGGAGGAAGG - Intergenic
1069138390 10:64794018-64794040 CAAGAAAGAGAGAAGGAAGAAGG - Intergenic
1070167455 10:73909594-73909616 CAGGAAGGTAGGAAGGAGGAAGG - Intronic
1070279409 10:75037849-75037871 CAGGACGGTGAGGAGGAGGATGG - Exonic
1070353163 10:75613022-75613044 CAGGAACGTCAAAAGAAGGAAGG - Intronic
1070427719 10:76305415-76305437 CATGAAAGAAAGAAAGAGGAAGG - Intronic
1070521813 10:77260306-77260328 CAGGAAGGACAGAGAGAGGAAGG + Intronic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1070628568 10:78068221-78068243 GGGGACAGACAGAAGGAGGATGG + Intergenic
1070702465 10:78613557-78613579 GAGGAAAGGGGGAAGGAGGAAGG + Intergenic
1070837002 10:79454364-79454386 CAGGAAAGCCAGTAGCAGGAAGG - Intergenic
1071161648 10:82753528-82753550 GAGGAAAGAAAGAAGGAGGGAGG - Intronic
1071256571 10:83877170-83877192 GAGGAAAGTCAGAAGCAGCTTGG - Intergenic
1071468456 10:85961733-85961755 AAGGAAAGATAGAAGGAGGATGG - Intronic
1071468508 10:85962014-85962036 AAGGAAGGAAAGAAGGAGGAAGG + Intronic
1071679934 10:87694882-87694904 GAGGAAACTCAGAAGGAGTAGGG + Intronic
1071796896 10:89017723-89017745 CAGCGAGGGCAGAAGGAGGAAGG - Intergenic
1073018296 10:100419603-100419625 AAGGAAAGAAGGAAGGAGGAAGG + Intergenic
1073397877 10:103233044-103233066 CAGGAAATTCAGAATGACAACGG + Intergenic
1073785687 10:106886599-106886621 CAGGAAAGAAGGAAGAAGGATGG + Intronic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1074561884 10:114542520-114542542 GAAGAAAGGAAGAAGGAGGAGGG + Intronic
1074612020 10:115030938-115030960 TGGGAAGGTCAGAAGGAGGGAGG - Intergenic
1074828036 10:117228631-117228653 AGGGAAAGACAGAGGGAGGAAGG - Intergenic
1075222890 10:120600267-120600289 CTGGAAAGTCACAAGGGGGATGG + Intergenic
1075570045 10:123534958-123534980 TAGGGAAGTCACAAGGGGGAGGG + Intergenic
1075573759 10:123563588-123563610 CAGGACAGACAGAATGAGTAGGG - Intergenic
1075873172 10:125785967-125785989 CAGGAAGGACACAAGGAGGCTGG + Intronic
1076090429 10:127680805-127680827 CAGGGAAGCCAGCTGGAGGAAGG + Intergenic
1076150889 10:128161225-128161247 AAGGAAAGCGAGAATGAGGAAGG - Intergenic
1076163993 10:128267783-128267805 GAGGAAAGGAAGGAGGAGGAAGG - Intergenic
1076232398 10:128832525-128832547 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1076375365 10:129980102-129980124 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1076444972 10:130508041-130508063 CAGAAAAGACAGATGGATGAGGG - Intergenic
1076449686 10:130548372-130548394 CAGGAAGGAAGGAAGGAGGAAGG + Intergenic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1077163264 11:1123143-1123165 AAGGAAAGACGGAGGGAGGAAGG - Intergenic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1079292436 11:19200477-19200499 AAGGAAAGAGAGAAGGAGGGAGG - Intronic
1079300538 11:19275293-19275315 CAGGAAGGTGCGAAGGAAGAAGG + Intergenic
1079339094 11:19597437-19597459 CAGGGAAGTCAGTAGTAAGATGG - Intronic
1079736700 11:24006329-24006351 CAGGAAAGAGAGAACAAGGAAGG + Intergenic
1080466692 11:32504094-32504116 AAGGAAGGAAAGAAGGAGGAAGG + Intergenic
1080904772 11:36531874-36531896 CATTAAAGTCAGAAGGAAGAAGG - Intronic
1081440171 11:43072160-43072182 CAAGATACTCAGAAGGAGAAAGG + Intergenic
1081525491 11:43924897-43924919 TAGGAAAGTCAGAGAGAGGAGGG + Intergenic
1082059851 11:47850478-47850500 CTGGAAAGAAGGAAGGAGGAAGG + Intergenic
1082655431 11:55850481-55850503 CAGTGAAGTCAGAAGGTGAACGG + Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1082830941 11:57616714-57616736 CAACAAAGTCAGGAGGTGGAAGG + Intergenic
1083014883 11:59443251-59443273 CAGGAAGGTCACAAAGAGGAGGG - Exonic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083920168 11:65778180-65778202 CGGGAAAGGCAGAAAGAGGTCGG + Exonic
1084363100 11:68681883-68681905 CAAGAAAGAAAGAAGGAGGGAGG - Intergenic
1084911913 11:72396277-72396299 GAGAAAAGGCAGAAGGAGGGAGG + Intronic
1085240895 11:75054249-75054271 CTGAAAAGTCAGGAGTAGGATGG - Intergenic
1085814132 11:79717763-79717785 CAGGAGAGTGAGAGGGAGAAAGG + Intergenic
1086312132 11:85547593-85547615 CCGGAAAGTGACAAGGAGAATGG - Intronic
1086853037 11:91833566-91833588 AAGGAAGGTGGGAAGGAGGAAGG + Intergenic
1087953946 11:104260157-104260179 TAGAAAAGTCACAAGGAGGAAGG + Intergenic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1088488042 11:110359870-110359892 AAGGAAAGTAGGAGGGAGGAGGG - Intergenic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089601986 11:119622044-119622066 CAGAAAGCTCTGAAGGAGGAAGG - Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090145132 11:124313223-124313245 AAGGAAAGAAAGAAGGAGGGAGG + Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090378699 11:126309886-126309908 CAGAAAAGGCAGAAGAAGAAGGG - Intronic
1090894009 11:130953089-130953111 AGGAAAAGACAGAAGGAGGAAGG - Intergenic
1091584591 12:1808905-1808927 CATGAAAGGGAGAAGGGGGAGGG + Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092597903 12:10027562-10027584 AAGGAAAGAAGGAAGGAGGAAGG - Intergenic
1092736696 12:11589485-11589507 CAGGAAAGAAGGAAGGAAGAAGG - Intergenic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1092982148 12:13807429-13807451 CAGGGAGGTGAGAAGGAGAAGGG - Intronic
1093772586 12:23034865-23034887 GAGGAAAGGAAGAAGGAGGGAGG - Intergenic
1094088228 12:26617741-26617763 AAGGAAGGACAGAAGGAGGGAGG + Intronic
1094125519 12:27018878-27018900 CAGGAGGGAGAGAAGGAGGAAGG + Intergenic
1094615134 12:32029577-32029599 AAGGAAAGAAAGAGGGAGGAAGG + Intergenic
1095083443 12:38032944-38032966 CATGAAAGTGACAAGGAGAATGG + Intergenic
1095180751 12:39144779-39144801 CGGGAAAGGCAGTAGGAGGGAGG + Intergenic
1095288680 12:40448686-40448708 AAGGAAGGAAAGAAGGAGGAAGG - Intronic
1095788027 12:46132024-46132046 CAGGAAAGCATGAAGGAGGAGGG + Intergenic
1096571393 12:52525399-52525421 CAGGAAAGCCAGATGGAATAAGG - Intergenic
1096612194 12:52809513-52809535 CAGGAATGCCAGTAGGAGGACGG + Intronic
1096628068 12:52907322-52907344 CAGGGAAGGCGGAAGGAGGGAGG + Intronic
1096806270 12:54143041-54143063 CAAGGAAGGAAGAAGGAGGATGG + Intergenic
1096875241 12:54624893-54624915 AAGGAAGGACAGAAGGAGAAGGG - Intergenic
1097212328 12:57381730-57381752 CAGGAAAGTGAGAATTAGGTGGG + Intronic
1097313633 12:58149199-58149221 CAAGAAAGAGAGAGGGAGGAAGG - Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097988445 12:65808931-65808953 CTGGAAACTGAGAAAGAGGATGG - Intergenic
1097996722 12:65896004-65896026 CAGGAAACTCAGCAGGACAAAGG + Intronic
1098179612 12:67832259-67832281 CAGGAGAGGCAGATGGAAGATGG + Intergenic
1098444859 12:70556059-70556081 CATCAAAGTCAGAATCAGGAGGG + Exonic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098939784 12:76520626-76520648 CAAGTAAGTCATAAGGTGGAAGG + Intronic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1099863561 12:88249597-88249619 CAGGAATGTCAGAAGCAGAAAGG + Intergenic
1100787049 12:98089787-98089809 AAGAAAAGACAGAGGGAGGATGG + Intergenic
1101489665 12:105199272-105199294 CATTAAAGTCAGAGGGAGGTGGG - Intronic
1101497638 12:105270515-105270537 TAGGAAGGTGAGAAGGAGGAAGG + Intronic
1101572842 12:105971008-105971030 AAGGAATGTAAGAAGGAGAAAGG + Intergenic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102655492 12:114479611-114479633 CAGGAAATTCAAAAGGAATAAGG - Intergenic
1103171700 12:118825889-118825911 AAGGAAAGAGAGAAGAAGGAAGG + Intergenic
1103245768 12:119455888-119455910 AAGGAAAGAAAGAAGGAGGGAGG + Intronic
1103367028 12:120390820-120390842 AAGGAAAGGAAGAGGGAGGAAGG + Intergenic
1103871235 12:124093761-124093783 CAGGGAAGGCAGCAGGAAGAGGG + Intronic
1104172519 12:126295900-126295922 AAGGAAAGAGAGAAGGAGGGAGG + Intergenic
1104247907 12:127060864-127060886 CAGGAGAGTCAGAAAGGAGATGG - Intergenic
1105284727 13:18994724-18994746 CCAGAAGGTTAGAAGGAGGAAGG + Intergenic
1105623454 13:22090746-22090768 TAGGAAAGTCAGACGCAGGATGG + Intergenic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1106015747 13:25867566-25867588 TAGGAAAGGGTGAAGGAGGATGG - Intronic
1106231728 13:27825941-27825963 CAGGAGAGAAAGGAGGAGGAAGG + Intergenic
1106442063 13:29784226-29784248 CGGGAAAGAAAGAGGGAGGATGG + Intronic
1106556845 13:30817113-30817135 AAGGAAAGTCTGAAGGACTATGG + Intergenic
1107151369 13:37115656-37115678 CATGAAAGTCACAGTGAGGAAGG - Intergenic
1107344818 13:39447837-39447859 CTGGAAAGTGAGAAACAGGAAGG + Intronic
1107550313 13:41468401-41468423 CAGGAGAGTGAGGAGCAGGAAGG - Intronic
1107859501 13:44647508-44647530 CAGCAAACTGAGAAGGAAGAGGG + Intergenic
1108144531 13:47463165-47463187 CAGAAAAGGCATAAGAAGGATGG + Intergenic
1108224806 13:48277554-48277576 CTGGAAAGAAAGAAGGAGGGAGG + Intergenic
1108593950 13:51934677-51934699 CAGGACAGCCAGCAGCAGGATGG - Exonic
1110109187 13:71722166-71722188 AAGGAAAGCCAAAAGGAAGATGG - Intronic
1110233525 13:73192253-73192275 CCGGAGAGTGAGAAGGAGGCAGG - Intergenic
1110261617 13:73491441-73491463 CATGAAAGTCAGAAGGGTGAGGG + Intergenic
1110932613 13:81241176-81241198 CAGGAAGGTCAAATGGAGAATGG + Intergenic
1111476417 13:88754355-88754377 CATGAAACTCAGTGGGAGGAAGG + Intergenic
1111681967 13:91453788-91453810 AAAGAAAGGAAGAAGGAGGAGGG - Intronic
1112343455 13:98571335-98571357 CATCAAAGTCAGAAAGAGGGTGG + Intronic
1112446761 13:99471574-99471596 CAGGAAAGAGGGAAGGAAGAGGG + Intergenic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112713744 13:102160081-102160103 TAGGAGAGTGAGATGGAGGAAGG - Intronic
1113244990 13:108385334-108385356 CAGGTAATTCAGAAGTAGTAAGG + Intergenic
1113268550 13:108646142-108646164 AAGGAAAGTAAGAAAAAGGAGGG + Intronic
1113316330 13:109183359-109183381 CATGAAAGTCACAGGGAGGTGGG + Intronic
1113405142 13:110031931-110031953 CTGGAAATTAAGAGGGAGGAAGG + Intergenic
1113427423 13:110220675-110220697 AATGATAGTCAGAAGGAGGACGG - Intronic
1113433318 13:110268834-110268856 CAGGTGAGACACAAGGAGGAGGG + Intronic
1113721802 13:112563059-112563081 CAGGAAAGTCCGAAGGGGGAGGG - Intronic
1113890373 13:113732254-113732276 CAGGGAAGTCAGAAGGGAGAGGG - Intronic
1114337616 14:21708340-21708362 AAAGAAAGAAAGAAGGAGGATGG - Intergenic
1114517396 14:23308774-23308796 CAGGAGAGAAAGAAGGAGAAAGG - Intronic
1114744416 14:25132563-25132585 CAGGAAAGTGAATAGGAGGCTGG + Intergenic
1114871791 14:26667155-26667177 TAGGAAGACCAGAAGGAGGAAGG - Intergenic
1115318046 14:32046941-32046963 CAGAAAAATGTGAAGGAGGAAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116073437 14:40080018-40080040 TAGGAGAGTGAGAAAGAGGAGGG - Intergenic
1116299819 14:43164328-43164350 AATGAAAGTCAGATGGGGGAAGG + Intergenic
1116808810 14:49519884-49519906 CAGGAAGGCCAGAAGGAGGGAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117243169 14:53856047-53856069 AAGGAAAGAAAGAAGAAGGAAGG + Intergenic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1117794640 14:59379714-59379736 CAGGAGAGTCAGAGGGAGAGAGG + Intergenic
1117964908 14:61197051-61197073 CATGAAAGTCAGAAGTGAGACGG - Intronic
1118172013 14:63396442-63396464 CAGGAGAGTCAGTAGAATGAAGG + Intronic
1118406766 14:65432114-65432136 CAGCAAAGTTATAAGGAGAAGGG - Intronic
1118816673 14:69318970-69318992 CAGGAAAGACGGAAGATGGAAGG - Intronic
1119243437 14:73082254-73082276 AAAAAAAGACAGAAGGAGGAGGG - Intronic
1119644165 14:76336578-76336600 CAGGAAAGACAATAGAAGGAAGG - Intronic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1119931448 14:78551632-78551654 CAGGAAAGAAGGAAGGAGAAAGG - Intronic
1120218161 14:81703147-81703169 AATTAAAGTCAGGAGGAGGAGGG + Intergenic
1120442740 14:84560264-84560286 CAGCTAAGTCAGCAGGAAGAGGG - Intergenic
1120617341 14:86723619-86723641 AAGGAAAGGCAGTGGGAGGATGG + Intergenic
1120677908 14:87443410-87443432 AAGGAAAGAAAGAGGGAGGAAGG + Intergenic
1121097358 14:91226961-91226983 CATGAAATTGAGAAGGAGGCTGG + Intergenic
1121123207 14:91389306-91389328 CGGGAAGGCCAGGAGGAGGATGG - Intronic
1121187623 14:91989900-91989922 AAGGAAAGTCACAAGCAGGATGG - Intronic
1121280350 14:92692998-92693020 CAGGAAGGTCACATGGAGAAGGG + Intergenic
1121316554 14:92964392-92964414 CAGGAAAGTCAGGGTGGGGAGGG + Intronic
1121338440 14:93091069-93091091 AAGGAAAGGCAGGAAGAGGAAGG + Intronic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122167667 14:99841430-99841452 CAGGAACGTCAGAAGGCAGGTGG + Intronic
1122246171 14:100404953-100404975 CAGGAAAGACAGAACTAGCATGG - Intronic
1122638026 14:103139229-103139251 CAGGAGACTCCGCAGGAGGAAGG + Intergenic
1122981822 14:105195476-105195498 AAGGAAGTCCAGAAGGAGGAGGG + Intergenic
1202936348 14_KI270725v1_random:91540-91562 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1124153103 15:27199932-27199954 CAGGAAAGAGAGAAGGATGAAGG - Intronic
1124469754 15:29973341-29973363 CATGAAGGTCAGAAGGTGGTGGG + Intergenic
1124479172 15:30062771-30062793 AAGAAAAGACAGAAGGAAGAAGG + Intergenic
1124879511 15:33628299-33628321 CAAGAAAGGAAGAGGGAGGAGGG + Intronic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125969139 15:43897912-43897934 CAGGAAAGAGAGAATGAGGGGGG - Intronic
1126269075 15:46791564-46791586 CAGGAAAATCGTGAGGAGGAGGG + Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126519422 15:49574472-49574494 CAGGAAAGACAGAAAGGGAAGGG - Intronic
1126703365 15:51386467-51386489 CAGGAAAGGGATAGGGAGGAGGG + Intronic
1127249451 15:57215917-57215939 CAGAAAAGTAAGATGGAAGAGGG + Intronic
1127316206 15:57796634-57796656 CAAGAAGGTCAGAAGTAGAATGG + Intergenic
1127660941 15:61099471-61099493 CAGGAAAGATACAAGGAGAATGG + Intronic
1127844368 15:62856709-62856731 TAGGAAAGTCAAAATGATGAGGG - Intergenic
1128115514 15:65102479-65102501 CAGGAGAGGCCGGAGGAGGAGGG - Exonic
1128405716 15:67335736-67335758 CAGGTGAGTCAGAAGGGGAAAGG - Intronic
1128583825 15:68829841-68829863 CAGGAGAGCCAGAAGGATAAAGG - Intronic
1128733598 15:70036957-70036979 CAGGAGGGTCAGCAGGTGGAGGG - Intergenic
1129248953 15:74297726-74297748 CAGGAAAGAAAGAAGAGGGAAGG + Intronic
1129486448 15:75878194-75878216 TAAGAAAGTGAGAAAGAGGAAGG + Intronic
1129524957 15:76208001-76208023 AAGGAATGTCAGGAGGAGGGTGG + Intronic
1129905248 15:79182627-79182649 AAGAAAAGACAGAAAGAGGAAGG - Intergenic
1129988413 15:79939643-79939665 AAGAAAAGACAGAGGGAGGAAGG + Intergenic
1129991754 15:79971271-79971293 CACGAAAGTGACTAGGAGGAAGG - Exonic
1130060026 15:80563048-80563070 GAAGGAAGTCAGCAGGAGGAAGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130481199 15:84360682-84360704 CAGGAACGGGAGAAGGGGGATGG - Intergenic
1130927481 15:88396426-88396448 AAGGAAGGGGAGAAGGAGGAGGG - Intergenic
1131559516 15:93427277-93427299 AGGGAAGGTCAGAAGGAGAAGGG + Intergenic
1131693130 15:94847405-94847427 CAGGATAATCAGATGTAGGAGGG - Intergenic
1131792069 15:95975800-95975822 CAGAAAAGAGGGAAGGAGGAAGG + Intergenic
1132250823 15:100334534-100334556 CCGGAGAGTCAGAGGCAGGACGG - Intronic
1132294174 15:100723209-100723231 CAGGAAAGTAAAAAGGAGAAAGG - Intergenic
1132536334 16:482936-482958 CAGGAAAGTCAGCTGGAACAGGG - Intronic
1132610630 16:814208-814230 CAGGAGAGTGGGAAGGAGGCCGG + Intergenic
1133937947 16:10284138-10284160 CAGGAAAGTGAGAAGGGGTGGGG - Intergenic
1134215132 16:12311428-12311450 CAGGAAAGGAGGACGGAGGAGGG - Intronic
1134234655 16:12455824-12455846 CAGGAAAGAAGGAAGGAGGGAGG - Intronic
1134851183 16:17480295-17480317 GAGGAAAGTCAGAGGCAGGAGGG - Intergenic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135491139 16:22910787-22910809 CAGGAAAGGTAGAAGGGGAAGGG + Intronic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136479630 16:30533447-30533469 CAAGAAAGGCAGAACCAGGAGGG + Intronic
1136483408 16:30556406-30556428 CAAGAAAGGCAGAACCAGGAGGG + Intronic
1136698700 16:32111958-32111980 AAGAAAAGTAAAAAGGAGGAGGG - Intergenic
1136705966 16:32188218-32188240 CGGGAGAGTCAGGAGGAGCAGGG - Intergenic
1136761947 16:32741187-32741209 CGGGAGAGTCAGGAGGAGCAGGG + Intergenic
1136768904 16:32815871-32815893 AAGAAAAGTAAAAAGGAGGAGGG + Intergenic
1136806153 16:33129201-33129223 CGGGAGAGTCAGGAGGAGCAGGG - Intergenic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1137442027 16:48505962-48505984 CAGGGAAGGTAGGAGGAGGAGGG + Intergenic
1137459528 16:48647916-48647938 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1138109767 16:54314319-54314341 CAGGAAAGAGAGAGGGAGCAGGG - Intergenic
1138265727 16:55658071-55658093 AAGGGAGGTCAGAGGGAGGAAGG + Intronic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138490299 16:57372609-57372631 CAGGACAGTCAGATGGCAGAAGG - Exonic
1138554387 16:57763331-57763353 CAGGCCAGGCAGGAGGAGGAAGG - Intronic
1138923610 16:61564066-61564088 CAAGAGATTAAGAAGGAGGAAGG - Intergenic
1139871385 16:70111372-70111394 CAAGAACTTCAGAGGGAGGAGGG + Intergenic
1140296572 16:73714810-73714832 CAGGAAAGTGAAAAGCAGCAAGG - Intergenic
1140364550 16:74371117-74371139 CAAGAACTTCAGAGGGAGGAGGG - Intergenic
1140665687 16:77225132-77225154 CAGGAGAGACAGAAGGAAAATGG - Intergenic
1140906694 16:79415352-79415374 CAGGCAGGCAAGAAGGAGGAAGG + Intergenic
1141141657 16:81500382-81500404 AAGGAGAGAGAGAAGGAGGAAGG - Intronic
1141417495 16:83887688-83887710 CGGGGAATTCAGAAGGAGGGAGG + Intergenic
1141845220 16:86603891-86603913 AAGGAAAGGAAGGAGGAGGAGGG - Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1203064105 16_KI270728v1_random:1001503-1001525 CGGGAGAGTCAGGAGGAGCAGGG + Intergenic
1203071321 16_KI270728v1_random:1077982-1078004 AAGAAAAGTAAAAAGGAGGAGGG + Intergenic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142599589 17:1047144-1047166 TAGGAAAGGCAGGAGGAGGAGGG - Intronic
1142889496 17:2933620-2933642 CAGGAAAGTGAGCAGGGGGCTGG - Intronic
1142928344 17:3260422-3260444 AAGGAAAGAGAGAAAGAGGAAGG - Intergenic
1143115890 17:4581771-4581793 CACGTAAGTGAGGAGGAGGAGGG + Intergenic
1143500744 17:7337101-7337123 CAGGAAGGGTAGAAGGAGGGTGG - Intronic
1143740818 17:8952828-8952850 CAGGAAAGGTAGGGGGAGGAGGG + Intronic
1143777715 17:9210231-9210253 CAGGAAGGTCTGAGGGAAGAGGG - Intronic
1143998346 17:11028973-11028995 CAAGAAAGCCAGTGGGAGGATGG + Intergenic
1144300862 17:13922207-13922229 ATGGAAAGCCAGAAGGGGGATGG - Intergenic
1144612859 17:16739400-16739422 CAAGAAAGTGAAAAGGAGGCTGG - Intronic
1144628225 17:16856424-16856446 CAGAAAAGACAGACGGAGCAAGG + Intergenic
1144730328 17:17522291-17522313 CAGGAAGTTCAGGAGCAGGATGG + Exonic
1144899926 17:18576187-18576209 CAAGAAAGTGAAAAGGAGGCTGG + Intergenic
1145132518 17:20369478-20369500 CAAGAAAGTGAAAAGGAGGCTGG - Intergenic
1145159817 17:20566991-20567013 CAGAAAAGACAGACGGAGCAAGG + Intergenic
1145692853 17:26762208-26762230 AAGAAAAGTAAAAAGGAGGAGGG - Intergenic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1146000942 17:29129958-29129980 GAGGAAAGCCAGAAGAGGGAGGG - Intronic
1146134950 17:30311370-30311392 CAGGAGTGTCAGAAGAAGTAAGG + Intergenic
1146153251 17:30495994-30496016 CAGGAAGGTCAAGAGGGGGAAGG - Intronic
1146908635 17:36633644-36633666 GAGGAAGGGGAGAAGGAGGAGGG + Intergenic
1147284867 17:39394180-39394202 CAGGAAAATCCAAAGGAGGGAGG - Intronic
1147319915 17:39639883-39639905 CAGAAAAGCCACAGGGAGGAGGG - Intronic
1147548819 17:41423742-41423764 CAAGTAAGTCAGGATGAGGAGGG - Exonic
1147550798 17:41440141-41440163 CAAGTAAGTCAGGCGGAGGAGGG - Exonic
1147652808 17:42071892-42071914 CCTGGAAGCCAGAAGGAGGAGGG + Intergenic
1148615174 17:48996198-48996220 CAGGAACGGCGGGAGGAGGAGGG + Intergenic
1148872015 17:50663852-50663874 CAGGAAGGTCAGCTGGAGCAGGG + Exonic
1149132174 17:53316122-53316144 CAGGGGAGTCAGAAGGGAGATGG + Intergenic
1149576692 17:57718726-57718748 CAGGAGAGAAAGAAGGAGAAAGG + Intergenic
1149614122 17:57983871-57983893 CAGAAAACTCAGATTGAGGAAGG + Intronic
1149789135 17:59462037-59462059 CAGGCAAGACATAAGGAGGTAGG + Intergenic
1150052678 17:61980258-61980280 AAGGAAATTGAGAAGGAGGTTGG - Intronic
1150269008 17:63850435-63850457 CAAGAAAGAAAGAAGGAGGGAGG + Intergenic
1150552219 17:66221340-66221362 AAGGAAAGAAAGAAAGAGGAGGG + Intronic
1150569054 17:66369753-66369775 CAGCCAACTCAGATGGAGGATGG - Intronic
1150645689 17:66976317-66976339 GAGGAAAGACAGAGGGAGGAGGG - Intronic
1151418320 17:73981246-73981268 TAAGAAACACAGAAGGAGGAAGG + Intergenic
1151756682 17:76079281-76079303 CAGGAAGGTGAGATGGAGCAGGG - Exonic
1151979911 17:77502660-77502682 CAGGAACTTCAGATGGGGGATGG - Intergenic
1152032354 17:77851779-77851801 CAGGACAGTGGGCAGGAGGATGG - Intergenic
1152939878 17:83162783-83162805 CACGTAAGTCACATGGAGGAGGG + Intergenic
1153521970 18:5962238-5962260 CAGGAAGGTCATCAGGAAGAAGG + Intronic
1153568203 18:6441863-6441885 AAGGAAAGAAAGAAGAAGGAAGG - Intergenic
1153993666 18:10421736-10421758 CAGAAAAGTCAGACAGAGAAGGG - Intergenic
1155402688 18:25456536-25456558 CAGGCAAATCAAAAGGCGGAGGG + Intergenic
1155416182 18:25602178-25602200 CAGGAATATCAGACAGAGGAAGG - Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156636680 18:39039315-39039337 AAGGAAGGACAGAAGGAGGGAGG + Intergenic
1156773159 18:40754544-40754566 CAAGCAAGACAGAATGAGGAAGG + Intergenic
1156857826 18:41803026-41803048 AAGGAAAGAGGGAAGGAGGAAGG + Intergenic
1157433169 18:47646921-47646943 CAGGAAAGGCAGGAGGAAGAAGG - Intergenic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1158106371 18:53889162-53889184 CAGGAATGTCACAAAGAGCAGGG + Intergenic
1158172732 18:54617650-54617672 CTGGAAAGTCAGCAGAGGGAGGG - Intergenic
1158370121 18:56791859-56791881 AAGGAAAGTGAGAGGCAGGAGGG + Intronic
1158651566 18:59292761-59292783 CAGCAAAGTAAGTAGAAGGATGG - Intronic
1158686210 18:59616837-59616859 CAGGAAAGTCAGGATGAGAAAGG - Intronic
1158857244 18:61554873-61554895 AAGGAAACCCAGAAGGAAGAGGG + Exonic
1159095734 18:63899411-63899433 CTGGAAATTCAGAAGAATGAAGG - Intronic
1159258663 18:65981194-65981216 AAGGAAAGGCAGAAAGAGAAAGG - Intergenic
1159384495 18:67706291-67706313 CAGGAAAGCAAGCAAGAGGATGG + Intergenic
1160032804 18:75277708-75277730 CAGTAATGGCAGAAGGAGGTAGG - Intronic
1160227306 18:77020912-77020934 CAGGAAAGTCATAAAGACGTTGG + Intronic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161373972 19:3929431-3929453 CAGCCAAGCCAGCAGGAGGAGGG + Intergenic
1161740917 19:6020713-6020735 CAGGAAAGGCAGCAGCTGGACGG + Intronic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162104710 19:8363444-8363466 AAGGAAAGAGAGAAAGAGGAAGG - Intronic
1162164954 19:8745997-8746019 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162166025 19:8753461-8753483 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162167091 19:8760917-8760939 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162169100 19:8774673-8774695 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1163272525 19:16262757-16262779 CTGGGGAGTCAGAAGTAGGATGG - Intergenic
1163902543 19:20117455-20117477 CAGCAGAGCCAGAAGAAGGAAGG - Intronic
1164441249 19:28282287-28282309 CAGGGGAGTCAGAAAGAAGATGG - Intergenic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164649906 19:29884233-29884255 AAGGAAAGGAAGAAGGAAGAAGG - Intergenic
1164671503 19:30074678-30074700 CAGGAGAGACTGGAGGAGGAAGG - Intergenic
1164937075 19:32223361-32223383 AAGGAAAGAAGGAAGGAGGAAGG + Intergenic
1165026988 19:32969459-32969481 CATGAATGGCAGCAGGAGGAAGG - Intronic
1165084926 19:33337911-33337933 GAGGAAAGAGAGAAGGAGGCCGG + Intergenic
1165247404 19:34505291-34505313 CAGGAAACTCAGGAGGAGTGTGG + Exonic
1165527050 19:36364949-36364971 AAAGAAAGAAAGAAGGAGGAAGG - Intronic
1165786970 19:38467428-38467450 CAGAAAAGTCAGAGAGAGGCAGG - Intronic
1165940023 19:39410281-39410303 GAGGGAAGTGAGAGGGAGGAGGG - Intergenic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166391036 19:42409054-42409076 CCTGAAAGTCAGAGAGAGGATGG + Intronic
1166503284 19:43356185-43356207 CACCAAAGCCAGCAGGAGGAAGG + Intronic
1166507170 19:43378576-43378598 CACCAAAGCCAGCAGGAGGAAGG - Intergenic
1166552482 19:43675597-43675619 CAGGTGAGTCACGAGGAGGAAGG - Intergenic
1166812490 19:45522566-45522588 CAGGAAAGTCAGCAAGGTGAGGG + Exonic
1166931433 19:46303841-46303863 CGGGAAAGAGAAAAGGAGGACGG - Intronic
1167126175 19:47550279-47550301 CAGGAAGGAAGGAAGGAGGAAGG + Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167801846 19:51748173-51748195 AAGGAAGGAAAGAAGGAGGAAGG + Intronic
1167803329 19:51760916-51760938 CATGAAACTCTGAAGAAGGAAGG + Intronic
1168159443 19:54499603-54499625 AAGAAGAGTCAGAAGCAGGAAGG + Intronic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168356953 19:55706615-55706637 CAGGAAAGAGAGAAAAAGGAGGG + Intronic
1168510190 19:56967471-56967493 GAGGAAGATCAGTAGGAGGAAGG - Intergenic
1202684201 1_KI270712v1_random:33952-33974 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
925147454 2:1590763-1590785 CCGGAAGGTCTGCAGGAGGAAGG + Intergenic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925265641 2:2564599-2564621 CAGTAAAGGCAGCAAGAGGAAGG - Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927108067 2:19844688-19844710 GAGGAAAGTATGAAGGAGCAGGG - Intergenic
927773078 2:25880491-25880513 AAGGAAATCCAGAAGGAGGGTGG - Intergenic
927877330 2:26666998-26667020 AAGGAAAGAGAGAAGGAAGAAGG - Intergenic
928070317 2:28208624-28208646 AAGGAAAGAAAGAAAGAGGAAGG - Intronic
928074829 2:28254625-28254647 CAGGAAATTAAAAAGGAGGCAGG - Intronic
928220427 2:29398691-29398713 CTGGAAACTGGGAAGGAGGAGGG - Intronic
928324829 2:30311157-30311179 CAGGAAAATGAGAGGGAGGAGGG + Intronic
928372085 2:30747535-30747557 CAGGACAGTGAAAAGGATGAGGG - Intronic
928835970 2:35545439-35545461 CAAGAAAGTCTGAGGCAGGAGGG + Intergenic
929336664 2:40756438-40756460 AAGGAAAGAAAGAGGGAGGAAGG - Intergenic
929430454 2:41881992-41882014 AAGGAAAGAGAGAAGGATGATGG - Intergenic
929448952 2:42023914-42023936 CAGAAAAGAAAGAATGAGGAAGG + Intergenic
930237435 2:48901527-48901549 CTGGATGGTCAGAAGGAGCAGGG - Intergenic
930871773 2:56178409-56178431 GAGGAAAGAAAGAAGGGGGAAGG - Intergenic
931285766 2:60830338-60830360 CATGCCAGGCAGAAGGAGGAAGG + Intergenic
931634476 2:64329192-64329214 CGGGAAACGCAGAAGCAGGAAGG - Intergenic
931803643 2:65783094-65783116 CAAGAAAGTCCGATGAAGGAAGG - Intergenic
933150749 2:78911962-78911984 AAGGAAAGTAGGAAGGAGAAAGG + Intergenic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
933393598 2:81703931-81703953 TAGCAAAGTCAGGAGGAAGAAGG + Intergenic
933409886 2:81911744-81911766 GAGGAAAGGAAGAAAGAGGAGGG - Intergenic
933783996 2:85823829-85823851 CAGGAAAGTGAGGAAGTGGAAGG + Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
933912239 2:86951850-86951872 CAGGAAATTAAGAGGGAGGCAGG + Intronic
934010755 2:87818047-87818069 CAGGAAATTAAGAGGGAGGCAGG - Intronic
934247518 2:90320900-90320922 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
934261806 2:91481701-91481723 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
934263651 2:91498371-91498393 AAGGAAGGAAAGAAGGAGGAAGG - Intergenic
934772989 2:96919838-96919860 CAGGAAAGACAGAAAGAGATGGG + Intronic
934928621 2:98400731-98400753 CAGGAAGATCAGAGAGAGGAAGG + Intergenic
935124041 2:100207402-100207424 CATGAGGGACAGAAGGAGGAAGG - Intergenic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935383581 2:102478583-102478605 TAGGAAAGCAGGAAGGAGGATGG + Intronic
935626659 2:105177269-105177291 AAGGAAGGAGAGAAGGAGGAAGG - Intergenic
935754827 2:106268905-106268927 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
935774323 2:106458748-106458770 CAGGAAATTAAGAGGGAGGCAGG - Intronic
935905745 2:107837165-107837187 CAGGAAATTAAGAGGGAGGCAGG + Intronic
935957279 2:108389828-108389850 CAGGAAAGTAAGAGGTAGGCTGG - Intergenic
936127542 2:109802346-109802368 CAGGAAATTAAGAGGGAGGCAGG + Intronic
936217155 2:110569139-110569161 CAGGAAATTAAGAGGGAGGCAGG - Intronic
936233619 2:110725125-110725147 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
936255094 2:110904440-110904462 CAGGAAAGACAGAGGCAGGAGGG - Intronic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936426295 2:112423722-112423744 CAGGAAATTAAGAGGGAGGCAGG - Intronic
936499860 2:113058684-113058706 CAGGAAAGACAGAGGAAGGAAGG + Intronic
937062779 2:118992696-118992718 AAGGAAAGGAAGAAGGAGAAAGG - Intronic
937112717 2:119378784-119378806 CAAGAGAGTGAGGAGGAGGAGGG - Intergenic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937372428 2:121309313-121309335 CAGGAAAGAAGGAAGGAGGGAGG + Intergenic
937615835 2:123921358-123921380 AAGGAAAGAAAGAAGGAAGAAGG + Intergenic
938020078 2:127899153-127899175 CAGGAACCTTAGCAGGAGGAGGG + Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938308145 2:130268333-130268355 CAGGGAAGTGAAAAGGAGGAGGG - Intergenic
938447186 2:131388503-131388525 CAGGGAAGTGAAAAGGAGGAGGG + Intergenic
938959531 2:136328817-136328839 CAGGAAAGACAGAGGAAGAAAGG + Intergenic
938969814 2:136421793-136421815 CAGGGAAGTCAGAGGGAAAAAGG - Intergenic
939355455 2:141095827-141095849 CATGAATATCAGATGGAGGAGGG - Intronic
939393594 2:141600599-141600621 CAGCAAAGTCAGAAACATGAGGG - Intronic
939642211 2:144654382-144654404 GAGGAAAGTCATAAGGGGCAGGG + Intergenic
939679488 2:145112630-145112652 GAGGGAAGTCAGTAGGAGAAAGG + Intergenic
940088964 2:149895129-149895151 CCGGAAAGGCATAAGGAGGAAGG - Intergenic
940115484 2:150204076-150204098 CAGGAAGGAAGGAAGGAGGAAGG + Intergenic
940165779 2:150769249-150769271 CAGTAAAGTGAAAAAGAGGAGGG + Intergenic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
941063827 2:160878450-160878472 CAGGAGGGTCAGAAGGAGATGGG - Intergenic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
941778367 2:169417329-169417351 CAGAAAATTCAGAGGGAGGGAGG + Intergenic
942135486 2:172920874-172920896 CAGGTCTGTCAGAAAGAGGAAGG - Intronic
942365620 2:175223187-175223209 AAGGAAAGAGAGAAAGAGGAAGG - Intergenic
942579498 2:177402322-177402344 CAGGAAAGCCACAAGGAGACTGG + Intronic
942744242 2:179213531-179213553 CCTGAAAGTGAGAAGGAGAATGG + Intronic
942841634 2:180368949-180368971 CATGAAAATCAGGAGGAGAACGG - Intergenic
942884242 2:180903007-180903029 CAGGAAAGTTAGGAGAAGGAGGG - Intergenic
942932376 2:181511014-181511036 CTAGAAAGTCAGAAGGAGCCAGG - Intronic
944033743 2:195268299-195268321 CAGGAAAGTGACAGGGAGAATGG - Intergenic
944058617 2:195548305-195548327 AAGGAAAGGAAGAAGGAAGAGGG + Intergenic
944850445 2:203713943-203713965 TAGGAAAGAAAGGAGGAGGAGGG + Intronic
945717039 2:213370056-213370078 TAGAAAAGTAGGAAGGAGGAAGG - Intronic
946162005 2:217841164-217841186 CTGGAAAGGGAGAAGGGGGAAGG + Intronic
946385846 2:219384075-219384097 CAGGAAAAGCAGCAGGAGCAAGG + Intronic
946427298 2:219606164-219606186 CAGGAAGGGGAGAATGAGGAGGG - Intronic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
946762328 2:223006920-223006942 CAGGACATTCAGAAGAAGAATGG + Intergenic
946832654 2:223741839-223741861 GAGGAAAGAGAGGAGGAGGAAGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946906972 2:224426841-224426863 CAGGAAAGAGAGAAAGAGAAGGG - Intergenic
946971627 2:225099290-225099312 AAGGAAAGAAAGAGGGAGGAAGG - Intergenic
947219290 2:227777735-227777757 AAGGAAAGAAAGAAGGTGGAAGG - Intergenic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
948053004 2:234992414-234992436 GAGGAGTGTCACAAGGAGGAAGG + Intronic
948234178 2:236375048-236375070 GAGGAAAGTCCCAAGGAGGATGG + Intronic
948302140 2:236915508-236915530 CAGGAAATTCAGAAGGAGGTTGG - Intergenic
948570879 2:238916472-238916494 AGGGAAAGAAAGAAGGAGGAGGG + Intergenic
948572421 2:238926050-238926072 GAAGAAAGTCTGAAGGAGGAAGG + Intergenic
948755198 2:240155380-240155402 CCAAAAAGTCAGAGGGAGGAGGG - Intergenic
948783091 2:240336969-240336991 GAGCAAAGCCAGAAGGATGAAGG + Intergenic
948870244 2:240794159-240794181 CAGGGAAGCCTGACGGAGGAAGG - Intronic
948960871 2:241335805-241335827 CAGAGAAGTCAGAAAGGGGAAGG - Intronic
1168848000 20:958615-958637 CAGGGAAGTCAGAGAGAGGGTGG + Exonic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169244774 20:4016584-4016606 CAGGAGGGGCAGATGGAGGAGGG - Intergenic
1169757752 20:9061674-9061696 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1170033727 20:11968810-11968832 CATGACAGTCAGAAAGAGGGAGG + Intergenic
1170271407 20:14531095-14531117 CAGGGAAGGTAGGAGGAGGAGGG + Intronic
1170322004 20:15110474-15110496 GATGAAAGACAGAAGCAGGAAGG + Intronic
1170651320 20:18245270-18245292 CAGGAGAGCCAGCAGGAGCAGGG + Intergenic
1171031642 20:21682056-21682078 CACGAAACTGAGAGGGAGGAGGG - Intergenic
1171364501 20:24614592-24614614 TAGGAAAATCAAAAGAAGGAAGG + Intronic
1171370999 20:24661780-24661802 CAGGAGCGTCAGAAGGAAGCAGG + Intronic
1172595928 20:36151183-36151205 CAGGAAAGCCAGGAGGAGAACGG - Intronic
1173112405 20:40204604-40204626 AAAGAAAGGAAGAAGGAGGAAGG - Intergenic
1173144213 20:40510854-40510876 CAGGGAGGAAAGAAGGAGGAAGG + Intergenic
1173928869 20:46801554-46801576 AGGGAAAGTCAGATGGGGGAGGG + Intergenic
1174432937 20:50483781-50483803 CAGGAAACTTAGGAGAAGGAGGG + Intergenic
1174976537 20:55341920-55341942 AAGGCAAGTTAGATGGAGGAGGG + Intergenic
1175047311 20:56119192-56119214 CAAGTATGTCAGAAGGACGAAGG + Intergenic
1175551662 20:59821875-59821897 CAGGAAGTTGAGGAGGAGGAGGG + Intronic
1176587149 21:8598059-8598081 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1177235006 21:18377388-18377410 CATCAAACTCAGAAGGGGGAAGG + Intronic
1177412446 21:20747719-20747741 CAGTAAAGTCAGAGTGAGGAAGG - Intergenic
1178145030 21:29729303-29729325 CAGAAAAGTCAAAAAAAGGAAGG + Intronic
1178163945 21:29950273-29950295 AAGGAAGGAAAGAAGGAGGAAGG - Intergenic
1178598317 21:33974660-33974682 AAGGAAAGGAAGAAGGGGGATGG - Intergenic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1179073761 21:38098700-38098722 CAGGAAAGGGAGTAGGAGGCAGG - Intronic
1179141139 21:38726530-38726552 AAGGAAGGAAAGAAGGAGGAGGG - Intergenic
1179296314 21:40065956-40065978 CAGGAAACTCAGAGAGAGGTTGG - Intronic
1179337922 21:40475113-40475135 CACGACAGTCTGAAGGAGGAGGG - Intronic
1180269980 22:10575056-10575078 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1180587927 22:16909807-16909829 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1180750497 22:18121218-18121240 CAGGAAAGAAAAAAGGAGGGTGG - Intronic
1181090498 22:20469278-20469300 CAGGGAATTAAGAAGGTGGACGG + Intronic
1181387973 22:22558550-22558572 AAAGAAAGTCAGAAGGTGGGGGG + Intronic
1181408709 22:22703214-22703236 AAGGAAAGGCAGAGGCAGGAGGG - Intergenic
1181413982 22:22746343-22746365 AAGGAAAGGCAGAGGGAGGAGGG - Intronic
1181419628 22:22788866-22788888 AAGGAAAGGCAGAGGGAGAAGGG - Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1182134829 22:27891674-27891696 CAGGAGAGAGAGGAGGAGGAAGG - Intronic
1182270808 22:29152193-29152215 CAGCAAAGACTGCAGGAGGATGG - Intronic
1182415172 22:30216791-30216813 AAGGGAAGTGTGAAGGAGGAGGG + Intergenic
1183404842 22:37625295-37625317 GAGGACAGGCAGAAGAAGGAAGG + Intronic
1183445663 22:37852539-37852561 TAAGCAAGTCAGAAGGATGAGGG + Intronic
1184263122 22:43330962-43330984 CAGGAAAGGCAGTAGGCGGTGGG - Intronic
1184318084 22:43714331-43714353 AAGGAAGGATAGAAGGAGGAAGG + Intronic
1184406705 22:44304628-44304650 CAGGAGGGCCAGAAGGAGGCTGG - Intronic
1184610342 22:45599273-45599295 CAGGGCAGTCAAAAGGAGGATGG - Intronic
1184882119 22:47314356-47314378 CACAAAGGACAGAAGGAGGAAGG - Intergenic
1184950645 22:47840364-47840386 AAAGGAAGTCAGGAGGAGGAAGG - Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
950117671 3:10461956-10461978 CAGGAGAGTGGGAAGAAGGAAGG - Intronic
950126331 3:10511970-10511992 CAGGAATGTCAGAAGAGGAAAGG + Intronic
951035161 3:17925046-17925068 AAGGAAAGAAAGAAGAAGGAAGG + Intronic
951167413 3:19499322-19499344 CCTGAAAGTCACAAGGAGAATGG + Intronic
951175553 3:19594869-19594891 CCTGAAAGTCACAAGGAGAATGG - Intergenic
951502990 3:23411240-23411262 CAGCAAAGTCAGAAGCAGTTTGG + Intronic
951657417 3:25025339-25025361 CAGACAAGTCAAAAGGAGAAGGG - Intergenic
951679936 3:25284060-25284082 CAGCAAAATGAGAAGGAGGGAGG - Intronic
952729121 3:36620536-36620558 CTGGAAAGTCAGGAGCAGAAAGG - Intergenic
952832556 3:37577108-37577130 CAGGGAAGACAGAAAGATGAGGG + Intronic
953032505 3:39187722-39187744 CAGGAACGACAGAAAGAAGAAGG - Exonic
953164234 3:40450245-40450267 CAGAAAAATAAAAAGGAGGATGG - Intergenic
953592217 3:44269367-44269389 GAGGAAAGTGAGGAAGAGGAGGG - Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955636221 3:61032543-61032565 CAGCAAAACCAGAAGGAGCAGGG + Intronic
955819557 3:62881715-62881737 CAGCAGAGGCAGAAGCAGGAAGG - Intergenic
956053906 3:65278272-65278294 CAGGAGGGTGAGAAGTAGGAAGG - Intergenic
956095827 3:65714930-65714952 CCCGAAACTCAGAAGGAGCAGGG + Intronic
956643374 3:71435217-71435239 CAGGAAAGAAGGAAGGAAGAAGG + Intronic
956739393 3:72263470-72263492 CAGGAAGCTCAGAAGGAGTGGGG - Intergenic
956796346 3:72722130-72722152 CAGGAAGGAAGGAAGGAGGAAGG + Intergenic
957168912 3:76711724-76711746 CAGGTAAGTGAGAAGCAGCATGG - Intronic
957422903 3:79994860-79994882 CAGAAATATCAGAAGGAGCATGG - Intergenic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
958466598 3:94467528-94467550 CAGGATAGAAAGAAGGATGAAGG + Intergenic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959245220 3:103858927-103858949 CAGCAAAGTCAGCAGGAGACTGG - Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
959566314 3:107836033-107836055 CATGCAAGTCAGGAGGAGGTGGG - Intergenic
959962898 3:112320749-112320771 CAGGAAAGAAAGAAAGAAGAAGG + Intergenic
960198179 3:114796728-114796750 TAGGATAGTCAAAAGCAGGATGG + Intronic
960569565 3:119172558-119172580 CAGGAAACTCTGGAGGAAGATGG - Intronic
961064646 3:123864980-123865002 CAGGAAAGCCAGCAAGGGGAGGG - Intronic
961445362 3:126978122-126978144 ACGGGAAGTCAGAGGGAGGAGGG + Intergenic
961488243 3:127232510-127232532 CAGGGAGGTCAGCAGGAGGATGG - Intergenic
962226945 3:133620928-133620950 CATGAGAGTCAGAAGCAGGCAGG - Intronic
962491363 3:135897002-135897024 GAGGAAAGGGAGAGGGAGGAAGG - Intergenic
962959147 3:140293878-140293900 TAGGAAAGGTGGAAGGAGGATGG - Intronic
963086869 3:141445190-141445212 GAGGAAAGTCAACTGGAGGAAGG + Exonic
963116575 3:141735424-141735446 AAGGAAAGGGAGAAGGAGAAAGG - Intergenic
963794239 3:149615772-149615794 AAGGCAAGTGAGATGGAGGAGGG + Intronic
963928745 3:150979406-150979428 TAGGAAAGTAAAAAGGAGGAAGG - Intergenic
964431391 3:156610315-156610337 CAGGAAAGGCAGAAAGAGTCTGG + Intergenic
966346754 3:178989379-178989401 CAGGAAAGACAGAGAGAGCAGGG + Intergenic
966383274 3:179365651-179365673 AAGGGAAGTTAGAAGGAGGTAGG - Intronic
966396327 3:179507405-179507427 AAGGAAGGGAAGAAGGAGGAAGG + Intergenic
967057703 3:185844129-185844151 CAAGAACCTCAGCAGGAGGAGGG - Intergenic
967068057 3:185938091-185938113 GAGGAAAGGCAGAGCGAGGAGGG - Exonic
967270250 3:187726921-187726943 CACCAAAGTCAGCACGAGGAAGG + Intronic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
967890150 3:194359146-194359168 CAGGCAAGTCAGGAAGAGGTAGG + Exonic
968653697 4:1769831-1769853 CAGGGAAGTCAGGTGGAGTAAGG + Intergenic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
970023663 4:11597038-11597060 CAGACAAGTCTGAAAGAGGAAGG - Intergenic
971112356 4:23602552-23602574 AAGGAAAGGAAGAAGGAAGAAGG + Intergenic
971199065 4:24495452-24495474 CAGGAAAGGAAGAAGGAAGCAGG + Intergenic
971344583 4:25800019-25800041 CAGGATAGACAGAAAGAAGATGG - Intronic
971865169 4:32160513-32160535 AAGGAAGGAGAGAAGGAGGAAGG - Intergenic
971919443 4:32917820-32917842 AAGAAAAGAAAGAAGGAGGAAGG - Intergenic
972570122 4:40303100-40303122 CAGGAAGGAGAGAAGGAGGCCGG + Intergenic
973188695 4:47362139-47362161 GAGGAAAGTTACAAGAAGGATGG + Intronic
974122986 4:57662589-57662611 CAGGAGAGGGAGAAGGAGAAGGG + Intergenic
974168456 4:58235044-58235066 CAGGTCAGTCAGAAGGGAGAAGG - Intergenic
974323535 4:60385358-60385380 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
974491963 4:62575926-62575948 AAGGAAAGAAGGAAGGAGGAAGG - Intergenic
975096473 4:70462859-70462881 CAGGAACTGCAGCAGGAGGATGG + Intronic
975431000 4:74290749-74290771 CAGAAAAGTAATGAGGAGGATGG - Intronic
976153863 4:82121299-82121321 CAGGCAGGCGAGAAGGAGGAAGG + Intergenic
976448191 4:85156098-85156120 CAGGAAAGGAGGAAGAAGGAAGG + Intergenic
976571475 4:86616716-86616738 CAGGAAGCTTAGAAGGAGAAGGG - Intronic
977166703 4:93708765-93708787 CAGGAAAGAAGGAAGGAAGAAGG - Intronic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977299923 4:95256031-95256053 AAAGCAAGTCAGGAGGAGGAAGG - Intronic
977700911 4:100021749-100021771 GAGGAAAGAAAGAAGGAAGAGGG - Intergenic
977782663 4:100996511-100996533 CAGGAAAGTCAAAAAGGGGCAGG + Intergenic
978651163 4:111006909-111006931 CAGGAAAGTCAGTATAATGATGG - Intergenic
978718931 4:111882179-111882201 CATCAGAGTCAGAAGGAAGAGGG + Intergenic
978992943 4:115108995-115109017 TAGGAAAGCAAGAAGGAAGAAGG + Intronic
979687252 4:123524506-123524528 GAGGAAAGGAAGAAAGAGGAAGG - Intergenic
980096241 4:128494013-128494035 CAGAAAAGAAAGAAGGAAGAGGG - Intergenic
980260449 4:130441478-130441500 CCGGAAAGTGACAAGGAGAATGG - Intergenic
981269567 4:142829335-142829357 CAGGTAGATCAGAGGGAGGAGGG + Intronic
981749630 4:148081554-148081576 CACCAAAGTCAGAAGGCAGAGGG - Intronic
981766640 4:148258337-148258359 AAGGAAAGAGAGAAGGAGGCAGG + Intronic
982004235 4:151049249-151049271 TAGGAGAGCCAGAAGGAAGATGG + Intergenic
982099902 4:151957685-151957707 AAGGAAAGTCAAAGGGAAGAAGG - Intergenic
982109810 4:152043859-152043881 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
984496018 4:180497951-180497973 GAGGAAAGTCAGAAAAAGGATGG - Intergenic
984637885 4:182133019-182133041 CAGGCGAGTCAGGAGGAGGAGGG + Intergenic
984702230 4:182825777-182825799 GGGGAAAGGGAGAAGGAGGAGGG - Intergenic
984818922 4:183862762-183862784 AAGGAAACTCAGAAGAGGGAGGG + Intronic
984863729 4:184262968-184262990 CAGAAAAGTCAGAAGAATTAGGG + Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985416178 4:189737913-189737935 CAGGAAAATCAGAAGGATGCTGG + Intergenic
985487255 5:158552-158574 CAGGACGGGCAGAGGGAGGAGGG - Intronic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985766959 5:1785164-1785186 CAGGAAACTGAGCGGGAGGAAGG - Intergenic
985785204 5:1889713-1889735 CTGGAAACTCAGCAGGAGGGTGG - Intergenic
985857147 5:2437709-2437731 CAGCAAAGACAGAAGGAGAAGGG + Intergenic
985985596 5:3513461-3513483 CGGGAGAGGCAGAAGGAGAAGGG + Intergenic
986127789 5:4899432-4899454 CAGGGAAGTCAGAAGGACCAGGG - Intergenic
986365249 5:7022563-7022585 CAGGAAAGAGAGAAGGTGGCAGG + Intergenic
986544069 5:8876028-8876050 AAGGAAAGTCAACAGGAAGAAGG - Intergenic
986737086 5:10675853-10675875 CAGGAAAGTCACACTGAGGTTGG - Intergenic
986846650 5:11764102-11764124 CAGGAAAGTCAGAGTCAGGAAGG + Intronic
986848857 5:11786536-11786558 CAGGAAAGGCTGAAGCAAGATGG + Intronic
986968418 5:13303219-13303241 CAGGGAAGTCTTAAGGAGGTAGG + Intergenic
987117402 5:14736631-14736653 CGTGAAGGTCAGAAGGAGAAGGG - Intronic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
987549014 5:19353820-19353842 CAGGAAGGAAGGAAGGAGGAAGG + Intergenic
987605817 5:20134747-20134769 GACCAAAGTCAAAAGGAGGAAGG - Intronic
987722146 5:21650833-21650855 AAGGAAGGTCAAAAGGAGGAAGG - Intergenic
988187952 5:27890810-27890832 CAGGAGAGAGAGAAGGAGGGGGG - Intergenic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
988385804 5:30563543-30563565 CTGGCAAGTCAGATGGAGGCTGG + Intergenic
988529101 5:32011651-32011673 CAGGAGAGTGGGAAGGAGGAAGG - Intronic
988722100 5:33889529-33889551 AAGGAAAGTCACAAAGAGGGAGG - Intronic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
989090156 5:37722048-37722070 CAGGAAGCTCTGAAGGAAGATGG - Intronic
989214271 5:38888027-38888049 CAAGAAAGAAGGAAGGAGGAAGG + Intronic
989468492 5:41786134-41786156 CAGGAAAGTCAGAAGCTGCTGGG + Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990013047 5:51023415-51023437 CAGGAAGGCCAGAAGGGAGAAGG - Intergenic
990673194 5:58155611-58155633 CAGGAAAGTCTCAAGGATAATGG - Intergenic
990755424 5:59064108-59064130 AAGGAAAGAGAGAAGGAGGGAGG + Intronic
991202932 5:64015228-64015250 GAGGAAAGTCAATAGGAGGTAGG + Intergenic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
992068454 5:73128415-73128437 CAGGAAAGTAAGGTGGTGGAGGG - Exonic
992452247 5:76885377-76885399 CAGGAAAGTGGGAATGAGGTGGG + Intronic
992540585 5:77760379-77760401 AAGGAAAGGAAAAAGGAGGAAGG - Intronic
992552588 5:77873361-77873383 AAGGAAGGAAAGAAGGAGGAAGG - Intergenic
993403341 5:87480287-87480309 AAGAAAAGTCAGAAATAGGAAGG - Intergenic
993622386 5:90184016-90184038 CATGAAGGAAAGAAGGAGGAAGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994307645 5:98226380-98226402 TAGGAAAGAAAGAAGAAGGAAGG + Intergenic
994311923 5:98282953-98282975 TAGGAAACACAGAAGGAAGAAGG - Intergenic
994427532 5:99610630-99610652 CAAGTGAGTCTGAAGGAGGAGGG + Intergenic
995308728 5:110687094-110687116 AAGAAAGGTCAGAAGGAGAATGG - Intronic
995441329 5:112195620-112195642 AAGGACAGTCAGAGGGAAGAAGG - Intronic
995539348 5:113169277-113169299 CAAGAAACCCAGAAGGAGAAAGG + Intronic
996154384 5:120080002-120080024 CAGGAAAGGCACAATGAGGAGGG + Intergenic
996215056 5:120856195-120856217 TAGGGAAGCCAGAAGGGGGATGG - Intergenic
996338037 5:122406261-122406283 CAAGAAAGACAGGGGGAGGAGGG - Intronic
996438731 5:123465086-123465108 CAAAAAAGATAGAAGGAGGATGG + Intergenic
996538596 5:124605433-124605455 CACAATAGTCAGAAGGAGCAGGG - Intergenic
996847908 5:127921038-127921060 AAGGAAAGGAGGAAGGAGGAAGG + Intergenic
997183456 5:131857703-131857725 CAGCAAAGTGAGGTGGAGGAAGG - Intronic
997263492 5:132481225-132481247 CAGGAATGTCTGAGGGTGGAAGG - Intergenic
997281568 5:132651394-132651416 AAGGAAAGCCAGAAGGAGTGAGG - Intergenic
997948279 5:138221522-138221544 CATGAAAGTTAGAAGGGAGAGGG + Intergenic
997956340 5:138281400-138281422 CATGAAAGTTAGAAGGGAGAGGG + Intergenic
998128683 5:139640295-139640317 CAGGAAGGTGGGAGGGAGGAAGG + Intergenic
998798090 5:145840123-145840145 AAGGGAAGTCAGAAGAAGGTCGG - Intergenic
999068544 5:148717497-148717519 CAGGAGAGGCAGAAGGTGAAGGG - Intergenic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
999936722 5:156494721-156494743 CAGAAAAGTGGGAAGGAAGAAGG - Intronic
1000412893 5:160952203-160952225 CAGGAAAATCAAGTGGAGGAGGG + Intergenic
1001233575 5:170010457-170010479 CAGGAAGATGAGAAGGAGTAAGG + Intronic
1001325925 5:170723989-170724011 CAGCAGAGTCAGATGGTGGAGGG + Intronic
1001439922 5:171734819-171734841 CAAGCAAGTGAGAAGGTGGAAGG - Intergenic
1001455097 5:171854231-171854253 TAGGGAAGTGAGAAGGAAGAGGG - Intergenic
1001461820 5:171922521-171922543 AAGGCAATTCAGAAGGAAGAAGG + Intronic
1002434990 5:179225740-179225762 GGGGGAAGCCAGAAGGAGGATGG - Intronic
1002520959 5:179793111-179793133 CAGGAAACTCAGAGTGGGGAGGG - Intronic
1002618038 5:180467598-180467620 CCAGAAAGTCTGAAGCAGGAAGG + Intergenic
1002676303 5:180916111-180916133 CAAGAGAGTAAGAAAGAGGAAGG + Intronic
1002978421 6:2109930-2109952 CAGGAAAGTAAGGAGCAGGCAGG - Intronic
1003031488 6:2605000-2605022 CAGGAAAGATAGAAGCAGAATGG + Intergenic
1003031508 6:2605254-2605276 TAGGAAAGAGGGAAGGAGGAAGG + Intergenic
1003034634 6:2632277-2632299 CAGAAAAATCAGAGGGAGGTGGG + Intronic
1003342969 6:5239644-5239666 AAGGAAAGTGACAAGAAGGAAGG + Intronic
1003454480 6:6269027-6269049 AAGTAAAGGCAGAAGGAAGAAGG + Intronic
1003482407 6:6545994-6546016 CAGGAAAGGCTGAGGGAGGAAGG - Intergenic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1003583240 6:7361708-7361730 TAGGAAAATCAGAACTAGGAAGG + Intronic
1003637519 6:7846510-7846532 GGGGAAACACAGAAGGAGGAAGG + Intronic
1004131216 6:12921667-12921689 AGGGAAAGGAAGAAGGAGGAAGG + Intronic
1004915900 6:20331883-20331905 AAAGAAAGCCAGAAGGAGGTTGG + Intergenic
1005685159 6:28246802-28246824 AAGCAAGGTCAGAAGGAGTAAGG + Intronic
1006789698 6:36691838-36691860 CAGAAATGGCAGAAGCAGGATGG - Intergenic
1007021705 6:38527835-38527857 CATGAAAATCAGAAATAGGAAGG + Intronic
1007039379 6:38707603-38707625 GAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1007054967 6:38874112-38874134 AAAGAAAGAGAGAAGGAGGAAGG - Intronic
1007054972 6:38874155-38874177 AAAGAAAGAGAGAAGGAGGAAGG - Intronic
1007814601 6:44512443-44512465 CAGAAAAGACAGAATGAAGAAGG + Intergenic
1007989905 6:46244304-46244326 AAGGAAAGAAAGAGGGAGGAAGG - Intronic
1008362314 6:50635472-50635494 GAGGAAAGAGGGAAGGAGGAAGG + Intergenic
1008413657 6:51214042-51214064 CAGGAAGGTCAGGAGCAGGCAGG + Intergenic
1009450686 6:63796873-63796895 CAGGAAAGGAAGAAGGGAGAAGG - Intronic
1009705222 6:67240675-67240697 CAGAAAAGTTCAAAGGAGGAGGG + Intergenic
1009815987 6:68736118-68736140 CAGGAGAGGCTGAAGCAGGAGGG - Intronic
1010704290 6:79089600-79089622 AAGGAAAGAAAGAAGGAGGGAGG - Intergenic
1011410503 6:87061312-87061334 GTGGAAGGTGAGAAGGAGGAGGG + Intergenic
1011889339 6:92137651-92137673 CAGTACAGTCAGAAGGAATAAGG - Intergenic
1011949339 6:92944830-92944852 AAGGAAAGAAGGAAGGAGGAAGG + Intergenic
1011980850 6:93376004-93376026 GAAGATAGTCAGAAGGAGGTGGG + Intronic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012542063 6:100372664-100372686 CAGGAAAGCCACACGGAGGATGG + Intergenic
1013751133 6:113407733-113407755 CGGAAAAGTCAGAAGGAGTAAGG - Intergenic
1014057795 6:117036686-117036708 CAGGAAAGTTAGAAGCATGGTGG - Intergenic
1014505546 6:122249649-122249671 TAGGAAAGAAAGAAGGAAGATGG + Intergenic
1015042142 6:128733890-128733912 CAGGAAATTCAGAGGAAGGCTGG + Intergenic
1015281548 6:131440197-131440219 CTGGAAGGTCAGCGGGAGGATGG + Intergenic
1015582281 6:134738650-134738672 CAGGACAGTGAAAAGGAGGTAGG - Intergenic
1015882559 6:137883640-137883662 CAGGAAAGAGAGAAGTAGGCAGG + Intergenic
1016014368 6:139168571-139168593 CAGGACAGGTAGAAGCAGGAGGG - Intronic
1016199625 6:141392837-141392859 GAAGAAAGAGAGAAGGAGGAAGG - Intergenic
1016521578 6:144952518-144952540 AAGGAAAGTGGGAGGGAGGAAGG - Intergenic
1016744476 6:147563515-147563537 AAGGAAAGTTGGAAGGAAGAAGG - Intronic
1017041134 6:150309327-150309349 AAGGAAAGACAGAAGGAAGGAGG + Intergenic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017315977 6:153031917-153031939 CAGCAAAGTGTGAAAGAGGAAGG + Intronic
1017579163 6:155841907-155841929 AAAGCAAGTCAGAGGGAGGAAGG + Intergenic
1017687479 6:156928009-156928031 GAGGACAGTAAGGAGGAGGAAGG + Intronic
1017873354 6:158504008-158504030 CGGGCCAGTGAGAAGGAGGACGG + Exonic
1017950182 6:159129600-159129622 CAGGAAAGCAGGAAGAAGGAAGG - Intergenic
1017981189 6:159402170-159402192 CAGGAGAGCCAGAAAGGGGAGGG - Intergenic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018864232 6:167734965-167734987 GAGGAGGGTCAAAAGGAGGATGG + Intergenic
1018900258 6:168048364-168048386 CTTCAAGGTCAGAAGGAGGACGG - Intergenic
1019208035 6:170378955-170378977 CAGGCAAATCAGGAGGAGCAAGG + Intronic
1019327620 7:446062-446084 AAGGAAAGGAAGAAGGAGGGAGG + Intergenic
1019437098 7:1028009-1028031 CAGGAGAGTAAGTGGGAGGAGGG + Intronic
1019494609 7:1331978-1332000 CAGGACATTCTGAAGGAGGAGGG + Intergenic
1019508257 7:1404474-1404496 CAAGAAAGTCAGCAGGCGGAAGG + Intergenic
1021059991 7:16099457-16099479 CAGGAAAAACATAAGGAGAAGGG + Intronic
1021287075 7:18793551-18793573 AAGGAAGGGCAGAAGGAAGAGGG + Intronic
1021396769 7:20159005-20159027 AAGTAAAGACAGAAGGAGAAAGG - Exonic
1021930198 7:25573083-25573105 AAGGAAAGTCAGAAAGAGATGGG + Intergenic
1022216061 7:28262787-28262809 AAGGAAGGAAAGAAGGAGGAGGG - Intergenic
1022230396 7:28408397-28408419 AAGGAAATTCAGCAGGGGGATGG + Intronic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022636596 7:32142172-32142194 AAGAAAAGGCAGAAGGAGAAGGG + Intronic
1023139943 7:37091817-37091839 CAGGCAAGACAGAATGAGAACGG + Intronic
1023710443 7:42986896-42986918 CAGGATAGGAAGAAAGAGGAAGG + Intergenic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1023892496 7:44403246-44403268 CAGGAGAGTCAGAACTGGGATGG + Intronic
1024331504 7:48159988-48160010 CAGGAAGGCCAGCAGGAAGAAGG - Intergenic
1025830600 7:65045888-65045910 AAGGAAAGGAAGAAGGAGGGTGG - Intergenic
1025917755 7:65879674-65879696 AAGGAAAGGAAGAAGGAGGGTGG - Intronic
1026638887 7:72107031-72107053 AAAGAAAGAAAGAAGGAGGAAGG + Intronic
1026678351 7:72446940-72446962 GAGGAAAAGCAGAAGGGGGAAGG + Intronic
1026742250 7:72986186-72986208 CAGGAAAGGCAGATGGGGGAGGG - Intergenic
1026802098 7:73406606-73406628 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1026823639 7:73567180-73567202 CAGGAAAGTAGCCAGGAGGAGGG + Intergenic
1026842682 7:73679243-73679265 CCGGAACCTCAGAAGGAAGAGGG + Intergenic
1027028374 7:74870925-74870947 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1027101485 7:75378892-75378914 CAGGAAAGGCAGATGGGGGAGGG + Intergenic
1027230580 7:76269434-76269456 CAGAAAAGTGAGATGGGGGATGG + Intronic
1027787272 7:82596010-82596032 CAGGAAAGACAGAAGAGTGAAGG - Intergenic
1027855224 7:83502495-83502517 CATGGAGGTCAGAAGGAGGTGGG - Intronic
1027867028 7:83661176-83661198 CAGGAAACTTACAAGCAGGATGG - Intergenic
1028262785 7:88685654-88685676 AAAGAAAGAAAGAAGGAGGATGG - Intergenic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1028870405 7:95765361-95765383 CTGGAAACTAAGAGGGAGGAGGG + Intergenic
1028888554 7:95961358-95961380 AAGGTAATTAAGAAGGAGGATGG + Intronic
1029090882 7:98047308-98047330 CATGAGAGTGAGAAGGAGGAGGG + Intergenic
1029111919 7:98217083-98217105 CTGGAAAGGCAGAAGGGAGAGGG + Exonic
1029144982 7:98439349-98439371 AAAGAAAGACAGAAGGAGGGAGG - Intergenic
1029215111 7:98942392-98942414 CAGGAATGCCAGAAGCAGAAGGG - Intronic
1029436752 7:100568042-100568064 CAGGAAAGGCAGGAAGAGCAGGG - Exonic
1030562483 7:111107194-111107216 GAGGAAAGAGAGAAGGAAGAAGG - Intronic
1030754805 7:113274177-113274199 CAGGAAAGAGAGAATGAGCAAGG + Intergenic
1030841661 7:114360550-114360572 CAGGAAATTCAGAAGTAATAGGG - Intronic
1031386365 7:121156679-121156701 CAGAAATGATAGAAGGAGGATGG + Intronic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032066338 7:128774359-128774381 CAGCAAAGGAAGTAGGAGGAGGG - Intronic
1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG + Intronic
1033399948 7:141013203-141013225 CAAGATAGCCAGGAGGAGGAAGG + Intronic
1033954878 7:146834490-146834512 AAGGAAAGACAGATGGAGGATGG + Intronic
1034280526 7:149850808-149850830 CAGGTGGATCAGAAGGAGGAAGG + Intronic
1034575343 7:151992239-151992261 CATGAAAGTCAAAAGCAGAAAGG - Intronic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035568750 8:658878-658900 AAGGAAAGGCAGAGGAAGGACGG - Intronic
1035737790 8:1901299-1901321 CAGGAGAGTCACTGGGAGGAAGG - Intronic
1035814612 8:2526125-2526147 CAGGGATCTCAGAAGGATGAAGG + Intergenic
1036037251 8:5032491-5032513 CAGGACAGTGATAAGGAGAAGGG + Intergenic
1036057915 8:5280376-5280398 CCTGAATGTCAGAGGGAGGAGGG - Intergenic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036612505 8:10362558-10362580 TAGGAAACTCAGAAAGGGGATGG - Intronic
1036799712 8:11781266-11781288 CTGGAAGTTCAGAAGGAGGGTGG + Intronic
1037572607 8:20171421-20171443 CAGGAAGGCCAGGATGAGGAAGG + Exonic
1037692038 8:21190045-21190067 TAGAAAAGGCAGAATGAGGACGG + Intergenic
1037856404 8:22374351-22374373 GTGGAAAGTCAGATGCAGGATGG + Intronic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1037906398 8:22718301-22718323 CAGGAAAGGGATCAGGAGGATGG + Intronic
1038390067 8:27189322-27189344 CAGGAAAGTCATCACGTGGAGGG + Intergenic
1039007842 8:33060490-33060512 CAGGGAACTCTGAAGCAGGACGG - Intergenic
1039762164 8:40589712-40589734 AAGGAAAGGAAGAAGGAAGAAGG - Intronic
1040690960 8:49937872-49937894 AAAGGAACTCAGAAGGAGGAGGG - Intronic
1041016599 8:53597779-53597801 CTAGGAAGTGAGAAGGAGGAGGG - Intergenic
1041311519 8:56522388-56522410 CAGGAAAGTTAGATGCAGAAAGG + Intergenic
1041472547 8:58226383-58226405 CAGAAAAGGCAGAAGGAATAGGG - Intergenic
1041499583 8:58525933-58525955 CTGGAAAGTCAGAAAGGTGAGGG + Intergenic
1041866670 8:62582084-62582106 AAGGAAAGACAGAAGGAGGGAGG - Intronic
1041957108 8:63568450-63568472 CAGGAATTTCTGAAGGAAGATGG - Intergenic
1041967202 8:63692719-63692741 CACGATAGTCAGAAGCAGGATGG - Intergenic
1042141184 8:65680269-65680291 CAGGAGAGTCTAAAGCAGGAAGG - Intronic
1042236445 8:66617567-66617589 AAGGAAAGAGGGAAGGAGGAAGG + Intergenic
1042346831 8:67736146-67736168 CAGGAAAGTGAGATGGAGTCAGG - Intronic
1042502716 8:69526851-69526873 AAGGAAGGAAAGAAGGAGGAAGG + Intronic
1042525573 8:69761443-69761465 AAGGAAAGACGGAAGCAGGAGGG - Intronic
1042555893 8:70033468-70033490 CAAGAAAGTGACAAGGAGGTGGG + Intergenic
1042576039 8:70219667-70219689 CAGGAAGGGCAGGAGGAGGGTGG + Intronic
1042833598 8:73057288-73057310 CATGAAAGTGACAAGGAGAATGG + Intergenic
1044122115 8:88410841-88410863 GAGGAAACACAGAAGGTGGATGG + Intergenic
1044891762 8:96843391-96843413 AAGGAAAGAAAGAAGAAGGAAGG + Intronic
1045073368 8:98535123-98535145 AAGGAAAGTCAGAATCAGGGAGG + Intronic
1045432811 8:102128979-102129001 CAGGGAAGTCCCAAGGTGGAAGG + Intergenic
1046092951 8:109524828-109524850 AAGGAAGGACAGAAGGAGGGAGG - Intronic
1046400103 8:113694081-113694103 CATGGAAGCCAGAAGGAGGTGGG - Intergenic
1046752595 8:117941054-117941076 AAGGAATGTGAGAAGCAGGATGG - Intronic
1046761017 8:118020835-118020857 CATTAAAGTTAGAAGGAGGGTGG - Intronic
1047599023 8:126408043-126408065 CAGGAGAGGCAGTAGGATGAGGG - Intergenic
1047830853 8:128628150-128628172 CAGAAAAGAGGGAAGGAGGATGG - Intergenic
1048250961 8:132866592-132866614 AAGGAAAGAAGGAAGGAGGAAGG + Intergenic
1048526698 8:135209275-135209297 CAGCAAAGTGAGAAGTTGGAGGG + Intergenic
1048672302 8:136736758-136736780 CAGGTGAGTCAGAAGGCAGAGGG + Intergenic
1048773287 8:137918841-137918863 CAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1048971735 8:139648862-139648884 CAGGAAAGGCAGTGGGGGGATGG - Intronic
1049356681 8:142192655-142192677 CAGGAAGGAGGGAAGGAGGAGGG + Intergenic
1049441760 8:142612842-142612864 CCGGAAAGACAGACGGAGGGAGG + Exonic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1050345351 9:4680167-4680189 CAGGAAGGGGAGATGGAGGAAGG - Intronic
1050960721 9:11726903-11726925 CAGGAAAGACAGAACAAGGCTGG - Intergenic
1051014924 9:12463061-12463083 GAGGAAGGAAAGAAGGAGGAAGG - Intergenic
1051336617 9:16071434-16071456 CTGGAAAGTCTGAGGGAGCAAGG - Intergenic
1052777035 9:32742606-32742628 CAGGACAATCAGCAGGAGGCAGG + Intergenic
1053096552 9:35333545-35333567 GATGAAAGGGAGAAGGAGGAAGG - Intronic
1053409319 9:37905245-37905267 CTGGAAATTCAGAAGCATGAGGG + Intronic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053696841 9:40647385-40647407 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1053742878 9:41159090-41159112 CAGGAAAGTGAAAACGAAGAGGG + Intronic
1054308092 9:63446618-63446640 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1054406825 9:64770609-64770631 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1054440450 9:65256075-65256097 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1054489957 9:65765849-65765871 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1054793099 9:69274142-69274164 CGAGGAAGTCAGAGGGAGGAAGG - Intergenic
1055006219 9:71510475-71510497 CAGGAAAGACAGAAGAGTGAAGG + Intergenic
1055142344 9:72889847-72889869 CAGAAAAGTAAGAAGGAAGGTGG - Intergenic
1055340091 9:75272403-75272425 TTGGAAACTCAGAAGGGGGAAGG - Intergenic
1056422495 9:86442952-86442974 AAGGAAAGAGAGAAGGAGGGAGG - Intergenic
1057049964 9:91916112-91916134 CAGGAAAGCAACAAGGAAGAAGG + Intronic
1057218754 9:93244388-93244410 CAGGAGAGTATGAAGGTGGAGGG - Intronic
1057357859 9:94346536-94346558 AAGTAAAGTCAGAAGTAGGACGG + Intergenic
1057649890 9:96911073-96911095 AAGTAAAGTCAGAAGTAGGACGG - Intronic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058388032 9:104461500-104461522 CAGGTAAGAGAGAAGAAGGAAGG + Intergenic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1058572295 9:106359524-106359546 CAGGAAATTCAGAAAGTGAAAGG - Intergenic
1058935808 9:109768140-109768162 AAGGAAAGAAGGAAGGAGGAAGG + Intronic
1058936121 9:109771308-109771330 TTGGAAAGTTAGAAGAAGGAGGG + Intronic
1059355317 9:113694726-113694748 CAGGAAAGACAGACAAAGGAAGG + Intergenic
1059373330 9:113861649-113861671 CAGAGAACTCAGCAGGAGGATGG - Intergenic
1059672293 9:116503016-116503038 AAGGAAAGAAAAAAGGAGGAAGG + Intronic
1060187359 9:121571869-121571891 CAGGACAGTCAGAGGCAGGAAGG + Intronic
1060892167 9:127195815-127195837 TAGGAAAGAAGGAAGGAGGAAGG - Intronic
1060931373 9:127491516-127491538 CAGGAGGGTCAGAGGAAGGAGGG + Intronic
1061413024 9:130431238-130431260 CAGGACAGGGAGAAGGAGCAGGG + Intronic
1061656790 9:132098047-132098069 GAGGAAAGGGAGAAGGTGGATGG + Intergenic
1061669968 9:132183144-132183166 CCAGGAAGCCAGAAGGAGGATGG - Intronic
1062144046 9:134979062-134979084 GAGGAAAGAGAGAAGGAGGAAGG + Intergenic
1202779293 9_KI270717v1_random:21044-21066 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1203617107 Un_KI270749v1:75774-75796 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1185574897 X:1163614-1163636 AAGGAAAGAAAGAAGAAGGAAGG + Intergenic
1185726562 X:2426530-2426552 AAGGAAAGAAGGAAGGAGGAAGG - Intronic
1185755441 X:2649823-2649845 AGGGAAAGTGAGAAGGAGGGAGG + Intergenic
1185836158 X:3347021-3347043 CAGGAGAGAGAGAAGGAGCAGGG + Intergenic
1186122444 X:6378684-6378706 GAGGAAAGACAGAGGGAGAAAGG + Intergenic
1186130934 X:6464661-6464683 CAGGTAAGACAGAAAGGGGAGGG - Intergenic
1186570494 X:10710161-10710183 CAGGAAATTCAGATGGGGGTTGG + Intronic
1186675121 X:11808414-11808436 AAGGACAGTGAGAAGAAGGAAGG + Intergenic
1186958354 X:14708001-14708023 CATGAAAGAAAGAAGGAGGGAGG - Intronic
1187182537 X:16956602-16956624 CAGGACAGACTGGAGGAGGAGGG - Intronic
1187274891 X:17808569-17808591 CTGGGAAGTAAGAAGGAAGATGG - Intronic
1187377914 X:18773686-18773708 CAGAAATGTCAGAAGTGGGAAGG - Intronic
1187866970 X:23731745-23731767 CAGGAAAGAGAGACAGAGGAGGG + Intronic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1188572845 X:31610062-31610084 CAGGAAGGACAGAGGGAGAATGG - Intronic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189716716 X:43874593-43874615 AAGGAAAGTTAGTAGGAGGGGGG - Intronic
1190123401 X:47682646-47682668 AAGGAAAGAAAGAAGGAGGAAGG - Intergenic
1191585646 X:62823730-62823752 CAGGGAAGTCAGGAAGAAGAAGG + Intergenic
1192138785 X:68630521-68630543 GAGGAAAGTGAGAAAAAGGAAGG + Intergenic
1192146999 X:68688772-68688794 GAGGAAAGTGAGAAAAAGGAAGG - Intronic
1192147522 X:68691738-68691760 CAGGAAACAAAAAAGGAGGAGGG - Intronic
1192184656 X:68938872-68938894 CAGGAAACTGAGAAGAGGGAGGG - Intergenic
1192353167 X:70373323-70373345 AAGGAAAGGAAGAAGGAAGAAGG + Intronic
1194981812 X:100449380-100449402 CAGGAAAATATGAAGAAGGAAGG - Intergenic
1195282585 X:103350350-103350372 CAGGAAACTCAGGAGGAGGCTGG + Intergenic
1196187348 X:112758556-112758578 CATGAAATTCAGAAGTAGCATGG - Intergenic
1196416690 X:115478764-115478786 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1196483041 X:116173092-116173114 CAGGAAGGTCAGAACATGGAAGG - Exonic
1196753670 X:119139362-119139384 CAGGAAAGTGGGAAGGTGGGAGG + Intronic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197804200 X:130383716-130383738 CAGTAAGGGCAGGAGGAGGAGGG + Intergenic
1197816326 X:130502347-130502369 GAAAAAAGTGAGAAGGAGGAGGG - Intergenic
1198064209 X:133080258-133080280 CAGGAGAATCAGAAGAAAGAAGG + Intronic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198714322 X:139540231-139540253 GAGAAAAGTCAGAATGAGAAGGG - Intronic
1198985455 X:142447218-142447240 CAGGAATGTGAGAATGAGGATGG + Intergenic
1199135847 X:144251801-144251823 CAAGAAATTCAGAAGCAGAAAGG + Intergenic
1199295211 X:146149378-146149400 CAGGAAAGCAAAAAGAAGGAGGG - Intergenic
1199595789 X:149504963-149504985 AAGGAAAGAAGGAAGGAGGAAGG + Intronic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1199992888 X:152999012-152999034 GAGGAAAGTGAGATGGAGCAGGG + Intergenic
1201194569 Y:11479325-11479347 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1201254278 Y:12091682-12091704 CAGGAATGAGAGAATGAGGAGGG - Intergenic
1201334887 Y:12869957-12869979 CAGGAGGGAGAGAAGGAGGAAGG - Intergenic
1201612010 Y:15853246-15853268 CATGAAAGTGATAAGGAGAATGG + Intergenic
1201613395 Y:15868354-15868376 CAGGTAAGACAGAAAGGGGAAGG - Intergenic
1202057182 Y:20847297-20847319 CATGAAAGTAACAAGGAGAATGG - Intergenic