ID: 923810103

View in Genome Browser
Species Human (GRCh38)
Location 1:237305321-237305343
Sequence ATTTTTGAGATTAATCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 5, 2: 17, 3: 91, 4: 381}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923810103 Original CRISPR ATTTTTGAGATTAATCCATG TGG (reversed) Intronic
902420314 1:16273959-16273981 GTTTTTGAGATTCATCTATGTGG - Intronic
907291997 1:53421208-53421230 AATAATGACATTAATCCATGAGG - Intergenic
908407062 1:63825374-63825396 GTTTTTGAGGTTTATCCATGTGG - Intronic
908423210 1:63979806-63979828 CGTTTTCAGATTCATCCATGTGG - Intronic
908534169 1:65063501-65063523 ACTTTTGAAATTAATCCATGGGG + Intergenic
908587155 1:65582365-65582387 AGTTTTGAGATAAATTCTTGGGG + Intronic
909127130 1:71686701-71686723 ATTTTCTAGATTATTCAATGGGG - Intronic
909230116 1:73077968-73077990 GCTTTTGAGATTAATCCATGTGG - Intergenic
911712130 1:101085893-101085915 ATTTTTGGAATTAATGAATGAGG + Intergenic
912233144 1:107818583-107818605 CTTTTGGAGATGAATCCCTGGGG - Intronic
912637120 1:111307297-111307319 GTTTTTGAGATTTATCCACTTGG - Intronic
915242932 1:154536802-154536824 GTTATTGAGATGCATCCATGTGG + Intronic
915360238 1:155281969-155281991 ATTTGTGAAATTCATCCATAGGG + Intronic
915382570 1:155455399-155455421 GTTTTTGAGATAAATCCAAAGGG - Intronic
915878465 1:159639533-159639555 AATTTTGTGAATATTCCATGAGG + Intergenic
916902516 1:169244744-169244766 ATTTTTGATATAGATACATGTGG - Intronic
918161689 1:181906938-181906960 TATTTTGAGATCCATCCATGTGG + Intergenic
918776266 1:188635369-188635391 ATTTTTGTAATTAATTCAAGGGG + Intergenic
919288085 1:195591245-195591267 ATTTTTTAGATTAAAAAATGTGG - Intergenic
919350464 1:196446644-196446666 ATTTTTGAGATATATCAATTAGG + Intronic
921047300 1:211486546-211486568 ATGTTAGAAAATAATCCATGGGG + Intronic
921467835 1:215511430-215511452 CTTTTTGAGTTTAATCTATTTGG - Intergenic
921754593 1:218840046-218840068 ATTTTTGAAAATAATTCAAGAGG + Intergenic
922417544 1:225435372-225435394 AGTTTTAAGATTAATCCAGCGGG - Intergenic
922426168 1:225496946-225496968 CTTTTTTAGATTTATGCATGTGG - Exonic
922954901 1:229590972-229590994 ATTTTAGAGATTTATCATTGTGG + Intergenic
923415577 1:233756237-233756259 ATTTCTGACATTCATCCATAAGG - Intergenic
923810103 1:237305321-237305343 ATTTTTGAGATTAATCCATGTGG - Intronic
923901714 1:238333216-238333238 GTTTTTGTGACTTATCCATGTGG - Intergenic
923948401 1:238918691-238918713 ATTTTTGAGATTCATCCATGTGG - Intergenic
924112090 1:240710291-240710313 CTTTTAGAAACTAATCCATGTGG - Intergenic
924197841 1:241626886-241626908 ATTTTATAGTTTAATCCTTGAGG - Intronic
1064061164 10:12138659-12138681 CTTTTTGAGATTAATTCATATGG + Intronic
1065099250 10:22317355-22317377 TTTTTTGAGATTAACCCAGGTGG - Intronic
1065268713 10:24004306-24004328 ATTTTTCAGGTTAAGCCAAGTGG + Intronic
1066402432 10:35089529-35089551 ACTGTTAATATTAATCCATGGGG + Intronic
1067244536 10:44526793-44526815 ATTTTTGAGATTCACCCACATGG + Intergenic
1067252861 10:44602429-44602451 TTTTTTAAGATTAATAAATGTGG + Intergenic
1067366801 10:45638800-45638822 ATTTGTTTGATTTATCCATGTGG - Intronic
1067399137 10:45955078-45955100 GTTTTCAAGATTAATCCATGTGG + Intergenic
1067867458 10:49924294-49924316 GTTTTCAAGATTAATCCATGTGG + Intronic
1067938153 10:50628656-50628678 TATTTTGAGATCCATCCATGTGG - Intergenic
1067962344 10:50868388-50868410 ATTTTGGAAATTAATTCTTGTGG + Intronic
1068054024 10:51988264-51988286 ATTTTTGAGATTTATCCATGTGG + Intronic
1068816977 10:61327506-61327528 GTCTTTGAGATTAATCCATGTGG - Intergenic
1068976037 10:63010670-63010692 GTCTTTAAGATTCATCCATGTGG - Intergenic
1070206542 10:74268840-74268862 ATTTTTACAATTAATCTATGTGG + Intronic
1070238118 10:74651834-74651856 GTTTTTGACATTCATTCATGTGG - Intronic
1070346619 10:75549109-75549131 GCTTTTGAGATTCATCCATGTGG + Intronic
1071152602 10:82652470-82652492 ACTTCTGAGATAAATCCATCTGG - Intronic
1071410149 10:85383163-85383185 AGTTTTGAGAGTTATTCATGTGG - Intergenic
1071696315 10:87876957-87876979 AATTTTCAGATTAATCTGTGAGG + Intronic
1072147866 10:92658715-92658737 GTTTTTGAGGTTTATCCATATGG - Intergenic
1072200829 10:93157283-93157305 ATTTTTCAAATTGATCCATGTGG + Intergenic
1072491996 10:95916818-95916840 ATTCTTGAGCATGATCCATGTGG + Intronic
1073956133 10:108873635-108873657 GTTTTTGATATTCATCCATCTGG + Intergenic
1074319715 10:112390766-112390788 ATTTTTAAGATTCATTGATGGGG - Intronic
1074486611 10:113889827-113889849 GTTTTTGAGATTCATCCCTGTGG + Intronic
1074637830 10:115341436-115341458 ATACTTGAGAGTGATCCATGTGG + Intronic
1074796104 10:116945926-116945948 GTTTGTGAGATTCATGCATGTGG - Intronic
1075359944 10:121822235-121822257 CTTTGTGAGATTTATCCATGTGG - Intronic
1076287191 10:129311717-129311739 ATCTTTGCCATTAATCCTTGGGG + Intergenic
1076699923 10:132266179-132266201 ACCTTTGAGATTCATCCACGTGG - Intronic
1077668312 11:4136137-4136159 ATTTTTGAGAGTACTCCTAGAGG + Intronic
1078044110 11:7897568-7897590 GTTTTTGAAATTCATCCATATGG - Intergenic
1078746078 11:14115559-14115581 GTTGGTGAGATTCATCCATGTGG + Intronic
1079153386 11:17922025-17922047 ATCTTTGAGACAAGTCCATGAGG - Intronic
1080742068 11:35075496-35075518 ATTTTTGAAATTCATTCATTGGG + Intergenic
1081076293 11:38677726-38677748 ATTTTTTAAATGATTCCATGAGG + Intergenic
1081158953 11:39729984-39730006 AATTTTTATATTAATCCATAGGG - Intergenic
1083970674 11:66072202-66072224 GTTTGTGAGAATCATCCATGTGG + Intronic
1084552596 11:69855126-69855148 ATTTTTAAGTTTCATCCATATGG - Intergenic
1084584324 11:70048453-70048475 GTTTTTGAGATTAGGCAATGGGG + Intergenic
1084746252 11:71171810-71171832 ATTAATCAGATTAATCCCTGTGG + Intronic
1085212443 11:74793079-74793101 CTTTTTGAGGTTCACCCATGTGG - Intronic
1085783961 11:79435584-79435606 ACTTTTTAGATTAATGGATGTGG + Intronic
1085949861 11:81317491-81317513 ATTTTTAAGGTTCATCCATGTGG - Intergenic
1086111117 11:83199422-83199444 GTTTTTGAGTTTTATCCATATGG + Intronic
1086965417 11:93022140-93022162 ATTTTGGACATTAGTCCATTTGG - Intergenic
1087180705 11:95139576-95139598 TTTTTTGAGATTTACCCATGTGG - Intergenic
1087342861 11:96930543-96930565 ATTTTTGAAATTTATCTATAGGG + Intergenic
1087400084 11:97653747-97653769 ATTTGTCAGGTTAGTCCATGTGG + Intergenic
1087416980 11:97869632-97869654 ATCATTGAGAATCATCCATGTGG + Intergenic
1087726938 11:101729490-101729512 ATTTTTGAGGTTTTTCCATGTGG + Intronic
1088034124 11:105291091-105291113 TATTTTGAGATTCATCCATGTGG - Intergenic
1088375705 11:109139453-109139475 ATCCTTGAGAATTATCCATGTGG + Intergenic
1088616408 11:111633971-111633993 ATTTCTTATATTCATCCATGTGG + Intronic
1088697552 11:112381249-112381271 GCATTTGAGATTAATTCATGTGG + Intergenic
1089018133 11:115183805-115183827 ATTTTTACGTTTAAGCCATGGGG + Intronic
1089266425 11:117266004-117266026 ATTTTTGAGATTCATCCATGAGG + Intronic
1090015928 11:123086600-123086622 ATTTTGCAGATAATTCCATGGGG + Intronic
1090376838 11:126295715-126295737 AAATGTGAGATTTATCCATGCGG + Intronic
1092535673 12:9384677-9384699 GTTGTTGAGGTTAATCAATGTGG + Intergenic
1093433449 12:19108829-19108851 GTTTTTAAGGTTCATCCATGTGG + Intergenic
1095223184 12:39643993-39644015 ATTTTTGAGCTCAAAGCATGTGG + Intronic
1097739911 12:63229293-63229315 TATTTTGAGATTCATCCATTAGG - Intergenic
1098333451 12:69377770-69377792 ATCCTTGAGAATGATCCATGAGG + Intronic
1098418163 12:70261203-70261225 ATTTTTGGGATAAATCCAACTGG + Intronic
1098441650 12:70525470-70525492 ATCTTTGAGATTCTTCCACGTGG - Intronic
1099079328 12:78156889-78156911 GGTTTTGAGATTCATCCATGTGG - Intronic
1099677212 12:85776627-85776649 ATTTTTTAAAATAATCCTTGTGG + Intergenic
1100095821 12:91035005-91035027 ATTTTTGAGATTATATCAAGGGG + Intergenic
1100476209 12:94937982-94938004 GTTTTCAAGGTTAATCCATGTGG - Intronic
1101157285 12:101939857-101939879 ATTTTTGAGATGCATCCAAAAGG + Intronic
1101296600 12:103430195-103430217 ATTTTTGAAATCTATCCATCTGG + Intronic
1102408872 12:112699479-112699501 GTTTTTGAGATTTGCCCATGTGG - Intronic
1102842850 12:116144539-116144561 ATGTTTGTGGTTAATCAATGTGG + Intronic
1102852987 12:116268485-116268507 ATTTTTGAGTATAATACAGGAGG - Intronic
1102854309 12:116279474-116279496 ATTTTTGAGATTAGGAAATGAGG - Intergenic
1103995071 12:124824240-124824262 GTTTTTGAGGTTTGTCCATGTGG - Intronic
1105072622 12:133244563-133244585 ATTTTTGAAATATATCCATCTGG - Intergenic
1105595210 13:21831102-21831124 ATTTTTGAGATTTTTTTATGTGG - Intergenic
1106322176 13:28651343-28651365 ATTTTTGTTTTTAATCCATATGG - Intergenic
1106355711 13:28981244-28981266 TTGTTTGAGATTAATCCATGTGG - Intronic
1106736821 13:32596327-32596349 TATTTTGAGATTCATCCATGGGG + Intronic
1107088992 13:36455902-36455924 ATTTTTGCAAGTCATCCATGAGG + Intergenic
1107130832 13:36893620-36893642 ATTTCTAAGATTAATCTTTGTGG - Intronic
1107323934 13:39219928-39219950 ATTTATAAGATTTGTCCATGTGG - Intergenic
1107858108 13:44635181-44635203 ATTTTTGGGATTGATCCAGAGGG + Intergenic
1108366806 13:49724075-49724097 ATTCTTCAGGTTCATCCATGTGG + Intronic
1108481283 13:50874714-50874736 AGTTTTGAGATTCATCCATGTGG + Intergenic
1108932720 13:55848366-55848388 ATCCATGAGATTTATCCATGTGG - Intergenic
1109320057 13:60799789-60799811 GTATTTGAGATTAATCACTGTGG - Intergenic
1111023637 13:82489355-82489377 GTTTTAGAGATTCATTCATGTGG + Intergenic
1111183524 13:84699199-84699221 ATTTTTGCAATCTATCCATGTGG + Intergenic
1111625748 13:90784138-90784160 TTTTTTGAAATTATTACATGTGG + Intergenic
1112536660 13:100264532-100264554 ATCTTTGAGATTCTTCCCTGAGG + Intronic
1115202897 14:30873330-30873352 GTTTTTGAGGTTCATCCATGAGG - Intergenic
1115523994 14:34261119-34261141 TATTTTTAGATCAATCCATGTGG + Intronic
1115729467 14:36252876-36252898 GTTTTTGAGATTTATCCATTTGG - Intergenic
1115833426 14:37369436-37369458 ATTATTTACATTAATTCATGTGG + Intronic
1116074753 14:40096921-40096943 ATTTTTGAAGTTCATCCATATGG + Intergenic
1117053999 14:51891705-51891727 TGTTTTGAGATTCATCCAGGTGG + Intronic
1117485585 14:56193662-56193684 ATATTTGAGATTAACTCATATGG - Intronic
1117865831 14:60148296-60148318 CTTTTAGAAATTAATCAATGGGG - Intronic
1118083748 14:62392536-62392558 CTTTTTGAGTTGAATCTATGTGG + Intergenic
1121152816 14:91652878-91652900 AGTATCAAGATTAATCCATGTGG - Intronic
1121966666 14:98313330-98313352 GTTTCTGATATTCATCCATGTGG + Intergenic
1121983053 14:98471551-98471573 ATTTTTGAAAATAATCTCTGTGG - Intergenic
1121989152 14:98538261-98538283 ATTCTGGATATTAATCCAGGTGG - Intergenic
1124229398 15:27930340-27930362 TATTATGAGATTCATCCATGTGG - Intronic
1124388456 15:29229912-29229934 ATCTGTGAGATTTCTCCATGTGG + Intronic
1124391863 15:29266586-29266608 GTATTTGAGATTCAGCCATGTGG - Intronic
1126984001 15:54281958-54281980 GTTTTTGAGTTTCATTCATGTGG + Intronic
1127141488 15:55982455-55982477 TTTTTTGAGAGTCATCCATGGGG - Intronic
1128209197 15:65881816-65881838 ACTTTTGAGATCACTGCATGTGG - Intronic
1128672173 15:69581913-69581935 ATTTTTCAGATTAAGCTTTGAGG + Intergenic
1128681754 15:69657550-69657572 GTGTTTGAGATTAATCCATCTGG - Intergenic
1130122922 15:81067605-81067627 ATTTTTGAAATTTTTCCATTTGG + Intronic
1130727650 15:86456961-86456983 ATTTTTGAAATGAATCCATAAGG - Intronic
1131030464 15:89182116-89182138 TTTTTTGAGAATAATCCATAAGG - Intronic
1131297275 15:91161008-91161030 TGTTTTGAGGTTAATCCGTGGGG - Intronic
1131494084 15:92889793-92889815 ATTTTTGTGAGTGATGCATGGGG + Intronic
1133674191 16:8054628-8054650 ATCTTTGAAATTACCCCATGAGG + Intergenic
1135151298 16:20008610-20008632 ATTTTTGGGGCTTATCCATGTGG + Intergenic
1136115757 16:28093367-28093389 ATTTTTCAGATTTATCCAAATGG - Intergenic
1136996195 16:35190513-35190535 ATTTGTGAAATAATTCCATGTGG + Intergenic
1139293968 16:65883812-65883834 GTTCTTGAGATTTAGCCATGTGG - Intergenic
1140956140 16:79867949-79867971 AGTTTTGAGGTTAATGCCTGGGG + Intergenic
1141915154 16:87091137-87091159 ATATTTCAGATTAATTCATTAGG - Intronic
1141988651 16:87596564-87596586 ATGCTTGAGATTCACCCATGTGG - Intergenic
1203143657 16_KI270728v1_random:1785375-1785397 TTTTTTAAGATTATTCCCTGGGG + Intergenic
1144185521 17:12791653-12791675 ATTTTTCAGCCTCATCCATGGGG + Intronic
1144569761 17:16389581-16389603 GTCTTTAAGATTCATCCATGTGG - Intergenic
1144591690 17:16529454-16529476 CTTTTTCAGATTTATCCATGTGG - Intergenic
1145361969 17:22219684-22219706 GTCTTTAAGATTCATCCATGTGG - Intergenic
1145404787 17:22578593-22578615 ATTTCTGCAATTACTCCATGTGG - Intergenic
1146158313 17:30543146-30543168 ATTTTTGAGATATATCCAAGTGG + Intergenic
1146523345 17:33544175-33544197 GGTTTTGAGATTCATCCATGTGG + Intronic
1147892960 17:43730239-43730261 ATTATCCAGATTAATCCAGGTGG + Intergenic
1148378780 17:47176162-47176184 ATATTTGATATTAATGCAGGGGG + Intronic
1148464586 17:47857340-47857362 ATTTGAGACATTTATCCATGAGG - Intergenic
1148813995 17:50313532-50313554 ATTTCTGAGATCGGTCCATGTGG - Intergenic
1149098746 17:52877092-52877114 TGTTTTGAGAGTCATCCATGCGG - Intronic
1149366333 17:55948860-55948882 GTTTTTGAGCTTAATCAATGGGG + Intergenic
1149643804 17:58224157-58224179 GATTTTGAGATTCATCCATGTGG - Intronic
1153664516 18:7357005-7357027 ATTTTACAGATTTATCCATGTGG + Intergenic
1154272208 18:12930039-12930061 GTTTTTGAGATTCACCCATGTGG - Intergenic
1155167441 18:23242753-23242775 ATCATGGAGATTAATCCAAGAGG - Intronic
1156567840 18:38216472-38216494 GTTTTTGAGATTCATTTATGTGG - Intergenic
1157554581 18:48604917-48604939 ATTTTCAAGGTTCATCCATGTGG + Intronic
1157664167 18:49471465-49471487 CTTTTTGAGATTCACCCATGTGG + Intergenic
1157968349 18:52236248-52236270 ACATTTGAGATTAATCCATGAGG - Intergenic
1158260401 18:55600009-55600031 ATCTGTGAGATTTGTCCATGTGG + Intronic
1159393506 18:67826725-67826747 AGTTTTAATATTAATTCATGAGG - Intergenic
1159689124 18:71463447-71463469 ATTTTTGAGATTCATCTACATGG - Intergenic
1160589257 18:79933104-79933126 ATTCTTGGGATAAATCCATGTGG - Intronic
1161761778 19:6178775-6178797 ATCTTTGTGATTTATCAATGGGG + Intronic
1162429332 19:10617986-10618008 GTTTGCGTGATTAATCCATGTGG + Intronic
1162963429 19:14142771-14142793 GCTTTTGAGATTTATCTATGTGG + Intergenic
1164425826 19:28140812-28140834 ATTTTCAAGATTTATCCATGTGG + Intergenic
1164707004 19:30327222-30327244 ATTGTTGAAATTAATCCAGGAGG + Intronic
1164936844 19:32221724-32221746 ACTATTAAGATTAATACATGTGG - Intergenic
1166245934 19:41525639-41525661 ATTTTTGAGAATGATCCATGTGG - Intergenic
925038352 2:709479-709501 GTTTTTGGGTTGAATCCATGTGG + Intergenic
927287738 2:21374247-21374269 ATTTTTCAAATTAATCAATGAGG + Intergenic
929480282 2:42300001-42300023 GTTTTTAAGATTCATCCATGTGG + Intronic
929498760 2:42471349-42471371 ATTATCAAGATTCATCCATGTGG - Intronic
930574831 2:53133658-53133680 TATTTTGAGATTCATCCATGTGG - Intergenic
931455364 2:62405923-62405945 GTTTTTGAGATTGATCCAAGTGG - Intergenic
931497444 2:62824641-62824663 ATTTTTGAAATTCATTCATAAGG + Intronic
931526033 2:63155293-63155315 ATTTTTGAGAGTAATGTGTGAGG + Intronic
931710271 2:64983757-64983779 ATCCTTCAGATTGATCCATGTGG + Intergenic
931917626 2:66975484-66975506 GTTTTTGAGATTTATCTATGTGG - Intergenic
932813940 2:74846573-74846595 TATTTTGAGATTCATCTATGTGG + Intronic
933412512 2:81943877-81943899 ATTTTTCTGATTTATCCATATGG + Intergenic
934474191 2:94581997-94582019 ATTTTTTATAATAAACCATGTGG - Intergenic
935249199 2:101246813-101246835 ATTTTTATGATGATTCCATGAGG + Intronic
935309127 2:101765657-101765679 ATTTTTGAAATGATTCAATGAGG + Intronic
935374777 2:102384537-102384559 TTTTTTGTGATTTATCCATTTGG + Intronic
935680623 2:105633645-105633667 ATTTGGGAGATGGATCCATGTGG - Intergenic
935948532 2:108308005-108308027 TGTTTTGAGATTCCTCCATGTGG + Intronic
936536179 2:113313205-113313227 ATCTTTCAGATAAATCTATGGGG + Intergenic
936587605 2:113772068-113772090 GTTTTTGAGGTACATCCATGTGG - Intergenic
937165404 2:119810461-119810483 ATTTGTGAGTTTTACCCATGTGG + Intronic
937599214 2:123709382-123709404 ATTTAGGAGAATAATCAATGTGG + Intergenic
937954490 2:127414207-127414229 GCTTTTGAGATTTATTCATGTGG - Intergenic
938472467 2:131577499-131577521 ATTTTTCAGGTTCATCCATATGG + Intergenic
940004210 2:148996695-148996717 ATTTTTGAGATTAAACCAGAAGG - Intronic
940102028 2:150051667-150051689 AATTGTGAGATTCATCCAGGTGG + Intergenic
940259405 2:151764817-151764839 CTTTTCAAGATTTATCCATGTGG - Intergenic
940460823 2:153960333-153960355 AGAGTTGAGCTTAATCCATGAGG + Intronic
941428321 2:165379275-165379297 ATTTTTAAGGCTCATCCATGTGG - Intronic
941458617 2:165739348-165739370 TTTTTTGATATGAATCCATGAGG - Intergenic
941738489 2:169007228-169007250 GATTCTGAGATTAATCAATGGGG + Intronic
942037440 2:172024308-172024330 CTTTTTGGTATTAATCCAAGTGG - Intronic
942915269 2:181297581-181297603 ATCCTTGAGAATGATCCATGTGG - Intergenic
942995111 2:182251086-182251108 ATTTTTGAAAATATTCCATTAGG + Intronic
943625173 2:190190340-190190362 ATGTCTGAGATTCATCCATGTGG + Intronic
943757389 2:191570661-191570683 TATTTTGAGATTCATGCATGTGG + Intergenic
944410807 2:199440342-199440364 ATTTTTGAGATCAGCCCCTGGGG - Intronic
946783081 2:223212776-223212798 ATTTGTCAGATTAATTCATTAGG + Intergenic
947368330 2:229419246-229419268 TTCTTTGAGATTCATTCATGAGG + Intronic
948416828 2:237813254-237813276 GTTTTTGATATTAACCCATGAGG + Intronic
948478291 2:238235232-238235254 ATTTTTTTGCTCAATCCATGGGG + Intergenic
1168815162 20:731628-731650 TGTTTTGAGATTCATCCATGTGG - Intergenic
1169640199 20:7742787-7742809 ATTTTAGACATTTGTCCATGTGG + Intergenic
1170950827 20:20934418-20934440 GTTTGTGAGATTCATTCATGTGG - Intergenic
1171112470 20:22496565-22496587 GCTTTTGAGATTCATCCATATGG - Intergenic
1172201604 20:33130926-33130948 AGTTGTGTGATTAATCCATGTGG - Intergenic
1173280867 20:41626278-41626300 ATCAGTGAGATTAATACATGAGG - Intergenic
1174440209 20:50545501-50545523 CTTTTTCAGACTAATCCATGAGG - Intronic
1174990346 20:55502258-55502280 ATTTTGGAAATTAATCCCTTTGG - Intergenic
1175349073 20:58305664-58305686 ATTTATGAGATTGATCCATGTGG + Intergenic
1176588973 21:8621678-8621700 ATTTGTGAGATTTTTCAATGTGG + Intergenic
1177081748 21:16648175-16648197 AATTTTGAGAGTGATCAATGAGG + Intergenic
1177126689 21:17202920-17202942 ATGTTTGAGATAAATTCCTGTGG - Intergenic
1177381133 21:20345860-20345882 ATTTTTGCAATCTATCCATGTGG + Intergenic
1177555096 21:22678953-22678975 ACTTTTGAGAAGAATCCATCAGG + Intergenic
1177680716 21:24366273-24366295 ATTTTACAGATTAATCTCTGTGG + Intergenic
1177933345 21:27313521-27313543 ATTTTTGAGAATGTTCCTTGTGG + Intergenic
1178033065 21:28550108-28550130 TTTTTTGAGATTAAAACATAAGG - Intergenic
1178256750 21:31059927-31059949 GTTTTTGAGATGCATGCATGTGG + Intergenic
1179448066 21:41447473-41447495 ATTTTCAAGGTTCATCCATGGGG - Intronic
1181498885 22:23304380-23304402 GTTTTTGAGGTTTATTCATGTGG + Intronic
1181665027 22:24389053-24389075 ATTTTTGAGGTTCTTCCACGTGG + Intronic
1181838664 22:25634145-25634167 ATTCTGGAGATTAATCCAAGGGG + Intronic
1184966471 22:47976219-47976241 ATTTGTGGGATTTATTCATGTGG + Intergenic
950344251 3:12277494-12277516 GTTTTTGAGGCTCATCCATGTGG + Intergenic
950385479 3:12655773-12655795 ATTTTTGAGGTTTATCCATGTGG - Intronic
950907171 3:16549782-16549804 ATTTTTGTATTTAATCCCTGTGG - Intergenic
951026566 3:17837206-17837228 ATATTTGTGATTAATCCTGGGGG + Intronic
951613447 3:24518229-24518251 ATTTTTGGCATTAGTCAATGTGG + Intergenic
953074539 3:39556432-39556454 ATTTTTGCAATTTATCCATCTGG + Intergenic
953604071 3:44397427-44397449 CATTTTGAGATTCATCCATGTGG + Intronic
954011469 3:47643485-47643507 GTTTTTAAGATTTATTCATGTGG - Intronic
955100459 3:55844394-55844416 GTTTGTGAGATTCATCCATCTGG - Intronic
955257777 3:57351605-57351627 ACTTTTGAGATTCATCCATGTGG - Intronic
955404953 3:58620152-58620174 AGTTCTGTGATTTATCCATGAGG - Intronic
955457365 3:59138626-59138648 GTTTTTAAGATCAATCTATGTGG - Intergenic
956049552 3:65233034-65233056 ATCTCTGAGATTTATCCATGTGG + Intergenic
956800081 3:72749428-72749450 TATTTTGAGATTCATCCATGTGG - Exonic
956933687 3:74075480-74075502 GTTTTTAAGGTTCATCCATGTGG + Intergenic
957234552 3:77568948-77568970 GTTTTTGAGGTTCATCCATGTGG + Intronic
957896624 3:86428930-86428952 ATTTTTTAGATTAACACATTTGG - Intergenic
957945759 3:87060371-87060393 AAATTTGAGATTAAGCCATGAGG + Intergenic
958044899 3:88271643-88271665 GTTTCTGAGATAAATCCATATGG + Intergenic
958469733 3:94502270-94502292 TATTTTGAGAATCATCCATGTGG + Intergenic
958921520 3:100111339-100111361 ATTTAAGAGATTACTCCATGAGG + Intronic
959924755 3:111908733-111908755 GTTTTAGAGATAAATCCTTGAGG - Intronic
960759526 3:121057618-121057640 ATTTATGAGTTCCATCCATGTGG + Intronic
962043094 3:131727891-131727913 TATTTTGAGATTTATTCATGTGG + Intronic
962577273 3:136766480-136766502 TATTTTGAGATTCATCCATGTGG + Intergenic
962632018 3:137286931-137286953 TATTTTGAGATTCATTCATGTGG + Intergenic
962822166 3:139060030-139060052 ATTTTTGCAATCAATCCATCTGG - Intronic
963170541 3:142246268-142246290 ATCCTTGAGAATGATCCATGTGG - Intergenic
963532643 3:146490077-146490099 AATTTTGAGAATGATCCATCTGG + Intronic
963959091 3:151287928-151287950 ATTTTTGTGATTAATAGAAGCGG + Intronic
964491725 3:157243301-157243323 GTTTTTGAGATTCATCCATGTGG - Intergenic
965238064 3:166154606-166154628 GTTTATGAGATTCATTCATGAGG + Intergenic
965859852 3:173135633-173135655 ATTTGTGAGATTCTTCCATGTGG - Intronic
965867914 3:173228174-173228196 ACTTCTGAAAATAATCCATGAGG + Intergenic
966356685 3:179087604-179087626 GTTTTTGCGATTTATCCATGTGG - Intergenic
966460625 3:180172310-180172332 TTTTTTAGGATCAATCCATGAGG + Intergenic
969107651 4:4819807-4819829 AATTTGGGGATTAATACATGGGG + Intergenic
970622315 4:17835762-17835784 ATTTTCGAGATTCATCCACATGG + Intronic
970654525 4:18216577-18216599 ATTTTTGAGATTAATCAATGTGG - Intergenic
970968031 4:21949526-21949548 ATTTTGGAGAAGCATCCATGTGG + Intergenic
971290934 4:25338692-25338714 GTTTTTGAGGTTCACCCATGTGG + Intronic
971534621 4:27733773-27733795 ATCTTTGAGATTAATACTGGTGG - Intergenic
972011153 4:34183771-34183793 ATTTTAGAGATTTATTCATTCGG + Intergenic
972711496 4:41600690-41600712 AATTTTTAGATGAATACATGGGG - Intronic
972842467 4:42947624-42947646 ATTTTGGAGATTTAGCCATTAGG - Intronic
972922517 4:43961539-43961561 ATTTTGGGGATGAATCAATGAGG - Intergenic
972986699 4:44773934-44773956 GTTTTTGGGAATAATCCAAGGGG - Intergenic
973069454 4:45838812-45838834 ATGTATAAGAATAATCCATGTGG + Intergenic
973684528 4:53355934-53355956 ACAGTTGAGATTAATACATGTGG - Intronic
974373801 4:61050432-61050454 AGTTTGGAGATGAATCCCTGAGG - Intergenic
974447006 4:61997448-61997470 ATTTTTGAGAGTATTTCAGGAGG + Intronic
975107680 4:70586831-70586853 ATTTTGGAGATTAATTCATGTGG + Intergenic
976446288 4:85133350-85133372 AATTTTGAGATCTTTCCATGAGG + Intergenic
977027425 4:91836645-91836667 ATTTATGTGATTCATCTATGCGG - Intergenic
977486965 4:97661288-97661310 GTTTTTGAGATGAATACATTTGG + Intronic
977837871 4:101666240-101666262 ATTTTTGACATTCATCCATTTGG + Intronic
978091356 4:104720198-104720220 ACATTTAAGATTCATCCATGCGG - Intergenic
978221255 4:106277536-106277558 ATTTCTGAGGGTCATCCATGTGG - Intronic
978560068 4:110023627-110023649 ATTTTTGCAATCAATCCATCTGG - Intergenic
978756679 4:112310202-112310224 ATTTTTCAATTTAACCCATGGGG - Intronic
978842830 4:113234740-113234762 AATTGTGAGATTATTCAATGTGG + Intronic
979911388 4:126370967-126370989 TTTTTTGAGGTTCATTCATGTGG + Intergenic
979936855 4:126709106-126709128 ATTTGAGAGATTAATACAGGTGG + Intergenic
980989418 4:139726230-139726252 ATTTGTGAGATTCATCCACGTGG + Intronic
981125658 4:141103266-141103288 TTTTCTGACATAAATCCATGAGG - Intronic
981714691 4:147741039-147741061 ATTTGTGAGATTCATCCAATTGG + Intronic
982989560 4:162254823-162254845 ATTTTTGAGATTGATCCATGTGG - Intergenic
983343346 4:166494802-166494824 AGTTTTTAGATTAGTCTATGAGG + Intergenic
983933488 4:173478051-173478073 ATTTTGGAGATAAATCCCTGAGG + Intergenic
984484445 4:180349954-180349976 ATTTTTGAGAAGAGTGCATGAGG + Intergenic
985001085 4:185483725-185483747 ATTTTCAAGGTTCATCCATGTGG + Intergenic
985295174 4:188429913-188429935 ATTTATGAAATTAATCTATGAGG + Intergenic
986354958 5:6914675-6914697 ATTTTTTTAATTAATCCCTGAGG - Intergenic
986803644 5:11287023-11287045 GTTATTGAGATTTATCCATGTGG - Intronic
986944073 5:12993116-12993138 ATTTGTGATATTCATCCACGTGG + Intergenic
987152221 5:15055051-15055073 CTTTTTGAGTTGAATCCATTTGG + Intergenic
987580104 5:19779088-19779110 AATTTTTATATTAATACATGAGG + Intronic
987665978 5:20940393-20940415 ATGCTTGAGATCAATCCATAAGG + Intergenic
987880556 5:23739240-23739262 ATTATCTAGATTTATCCATGAGG + Intergenic
988756709 5:34261785-34261807 ATGCTTGAGATCAATCCATAAGG - Intergenic
990737427 5:58879408-58879430 GTTTTTGTGATATATCCATGTGG + Intergenic
991140524 5:63235608-63235630 ATTTTTGAGGTTCATTCATGTGG + Intergenic
992244999 5:74811810-74811832 ATTTGTGAGATTCATCCATATGG - Intronic
992523113 5:77576880-77576902 ATTTTTAAGATTAATTTTTGTGG + Intronic
992964954 5:81990281-81990303 ATTTGTGTGATTATTCCTTGGGG + Intronic
993114101 5:83698818-83698840 ATTTTAGAGATTATACTATGGGG - Intronic
993197012 5:84762150-84762172 ATTCTTGAGAATGATACATGTGG + Intergenic
994615691 5:102101256-102101278 ATTTTTCTGATTAATCTTTGGGG + Intergenic
995894430 5:116995900-116995922 GCTTTTGAGAATAATCCATAAGG - Intergenic
995954560 5:117760274-117760296 TTTTTTGAGATTACCTCATGGGG + Intergenic
996676994 5:126187763-126187785 TATTTTGAGATTTATCCATGTGG - Intergenic
996710816 5:126541913-126541935 ATTTTTGTCTTTAATCCATTTGG - Exonic
996736878 5:126766360-126766382 GTTTATGAGATTCAACCATGTGG + Intergenic
996946435 5:129075324-129075346 TTTATTGTGATTAATACATGTGG - Intergenic
996979580 5:129474194-129474216 GTTTTTGAGGTTCATCCATGTGG + Intronic
996985562 5:129558865-129558887 AAATTTGAGATTAATTCATATGG + Intronic
998624071 5:143825552-143825574 ATTTTGGAGGTTAATCAAGGTGG + Intergenic
998845777 5:146308326-146308348 GTTTTTGAGATTTATCCACATGG - Intronic
999054030 5:148554400-148554422 ATTTTTAAGGTTCATCCATGTGG - Intronic
999919266 5:156300540-156300562 ATCCTTGAGAATGATCCATGTGG + Intronic
1000477758 5:161732525-161732547 ATTCTTTAGATTTTTCCATGTGG - Intergenic
1001797830 5:174516869-174516891 GTTTCTGAGGTTCATCCATGTGG + Intergenic
1003037032 6:2650701-2650723 TATTTTGAGATTCATCCATGTGG - Intergenic
1004670828 6:17795133-17795155 GTTTCTGAGATTCATCCATATGG + Intronic
1005280215 6:24265474-24265496 ATCCTTGAGAATGATCCATGTGG - Intronic
1005359930 6:25022365-25022387 GCATTTGAGAATAATCCATGTGG + Intronic
1006285496 6:33090877-33090899 ATTTTTGAGATCATTTTATGAGG + Intergenic
1007049120 6:38808088-38808110 GTTTTTGAGATTCATCCATGGGG + Intronic
1008962042 6:57276003-57276025 ATTTTGGAGATTTATCCATGTGG - Intergenic
1009798918 6:68507858-68507880 GTTTTTGAGATTCATCTATGTGG - Intergenic
1010079837 6:71847899-71847921 TCTTTTGAGAGTAATTCATGAGG - Intergenic
1010148517 6:72701339-72701361 ATTTTTGAGGTTAAACCAAGTGG - Intronic
1010864519 6:80958378-80958400 ATTTTTGAGAATCATCCATGTGG - Intergenic
1010957665 6:82108524-82108546 ATTTTGGAGAATGTTCCATGTGG - Intergenic
1011531211 6:88323096-88323118 ACTGTTGAGATTAATCCAAAAGG + Intergenic
1012134426 6:95538390-95538412 ATTTTAGAGTATAAGCCATGTGG + Intergenic
1012697241 6:102402195-102402217 AGATTTGAGATTATTCCATGTGG - Intergenic
1013036001 6:106383870-106383892 GTTTTTGAGATTAGTACATGGGG + Intergenic
1013864903 6:114684160-114684182 GGCTTTGAGATTAAACCATGTGG + Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1014627616 6:123748087-123748109 ATTTTTGAAATGAATACATGTGG - Intergenic
1014682354 6:124447435-124447457 ATTCTTGTAATTAATCCAGGAGG + Intronic
1014940625 6:127434259-127434281 TCTTTTTAGATTAATCCATAAGG + Intergenic
1015019480 6:128454920-128454942 ATTTTTCAGATTAGTCAATTTGG - Intronic
1015218757 6:130780517-130780539 ATTTTTGAGTGTAATTTATGTGG - Intergenic
1015381633 6:132576625-132576647 ATTTTCCAGATTACTTCATGTGG - Intergenic
1015901339 6:138071013-138071035 ATTTTTGAGTGTCATCCTTGAGG - Intergenic
1015948219 6:138524494-138524516 GTTTGTGAGATTCATCTATGTGG + Intronic
1017224929 6:152009934-152009956 ATTTTTAAGACTTAGCCATGTGG - Intronic
1017403195 6:154088161-154088183 TATTTTGAGATTCATCTATGTGG - Intronic
1019825952 7:3284522-3284544 GTTTTTGAGATTCATCCCTTTGG + Intergenic
1019912460 7:4108968-4108990 TGTTTTGAGATTTGTCCATGTGG + Intronic
1020830633 7:13090345-13090367 ATTCTTGTGATAACTCCATGAGG + Intergenic
1021016514 7:15542034-15542056 AATTTTGACAGTAATCCAAGAGG + Intronic
1021441293 7:20680106-20680128 GTTTTTGAGATTCATCCATTTGG - Intronic
1023234521 7:38070292-38070314 ATTATTTAGATTAATCCCTGAGG + Intergenic
1024490223 7:49973992-49974014 ATTTTTAAGGTTCATTCATGTGG - Intronic
1024624803 7:51197448-51197470 ATTTTAGAGTATAAGCCATGTGG + Intronic
1026236035 7:68528182-68528204 GTCTTGGGGATTAATCCATGGGG - Intergenic
1026252726 7:68685006-68685028 ATTCTTGAGCTTAATGAATGAGG - Intergenic
1026668651 7:72367023-72367045 ATTTGTGAGGTTCATCCATGTGG - Intronic
1030718326 7:112837493-112837515 TTTTTTGACACAAATCCATGTGG + Intronic
1031429185 7:121645445-121645467 ATTTTCGAGGTTCATTCATGTGG + Intergenic
1031553993 7:123148975-123148997 ATTTTTGAAATGACTCCATCTGG + Intronic
1031792356 7:126122489-126122511 GTTTTTGAGGTAACTCCATGTGG - Intergenic
1031794158 7:126150152-126150174 ATTTTTGAGATAAACACATCAGG - Intergenic
1032066179 7:128773144-128773166 ATTTTAGAGATTTTTGCATGTGG + Intronic
1032261396 7:130340195-130340217 TTTTTTGAGGTTCAACCATGTGG + Intergenic
1032611063 7:133414633-133414655 GTTTCTGAGATGTATCCATGTGG - Intronic
1032995247 7:137438785-137438807 ATTTTTGTGATTCATCCTTATGG - Intronic
1034576075 7:151999166-151999188 ATTTTTGAGGTTCATCCACATGG + Intronic
1036524538 8:9522380-9522402 CCTTTTGAGATTAATCTATTAGG - Intergenic
1038156479 8:24996084-24996106 ATTGTTGAGATTTATAAATGAGG - Intergenic
1039738635 8:40359275-40359297 ATTTTAGAAATTAATTCTTGAGG - Intergenic
1040065183 8:43139739-43139761 TGTTTTGAGATTTATCCATGTGG + Intergenic
1040687350 8:49890832-49890854 AATTATCAAATTAATCCATGGGG - Intergenic
1040813176 8:51480042-51480064 ATCTTTGAGTTTAATCAAGGAGG - Intronic
1042268107 8:66929111-66929133 TATTTTGAGATTCATCCATGTGG + Intergenic
1042351357 8:67780817-67780839 ATTTCTGAGATTTATCAATATGG + Intergenic
1042588706 8:70372904-70372926 ATTTTTGAGACTCATCCATATGG + Intronic
1043204156 8:77414664-77414686 ATTTTTGAGGTTAGTGCATTTGG + Intergenic
1043695540 8:83211511-83211533 ATTTTTGAGATTATAGCATATGG - Intergenic
1044255832 8:90059851-90059873 ATTTTAGAGATTAATCCTGGTGG + Exonic
1044288005 8:90431944-90431966 ATCTTTCAAAGTAATCCATGAGG - Intergenic
1044663120 8:94611034-94611056 GTTTTTGAGATTTATCCACCTGG - Intergenic
1044851126 8:96429561-96429583 ATCCTTGAGAATGATCCATGAGG + Intergenic
1046563874 8:115873613-115873635 ATTCTTTAAATTAATCCATGAGG - Intergenic
1048011754 8:130462894-130462916 ATCTGTGAGATTTGTCCATGTGG - Intergenic
1048125019 8:131624793-131624815 ATTTTTGACAATGTTCCATGAGG - Intergenic
1049111705 8:140649227-140649249 GTTTTTGGGATGCATCCATGTGG - Intergenic
1050800450 9:9605775-9605797 ATTATTGAGATTAATGCTTCTGG + Intronic
1050946790 9:11531771-11531793 GTTTTAAAGATTAAACCATGAGG - Intergenic
1051104393 9:13562326-13562348 ATTTGTGAGATTTATCAATGTGG + Intergenic
1051998072 9:23243345-23243367 ATTATTGATATTAATACAAGAGG + Intergenic
1052420594 9:28238357-28238379 ATTCTTGAGAATGATCTATGTGG - Intronic
1052557337 9:30033714-30033736 ATTTATGAGATTAGGGCATGGGG + Intergenic
1052583968 9:30400428-30400450 ATTTTTGAGTTTATTCCTTTTGG + Intergenic
1053084957 9:35211404-35211426 ATTTTGGAAATTATTCCATGTGG + Intronic
1053262466 9:36680891-36680913 GATTTTGAGACTTATCCATGTGG + Intergenic
1053459930 9:38260402-38260424 GTTTTTAAGATTCATACATGTGG - Intergenic
1053683887 9:40504134-40504156 ATTTTTTATAATAAACCATGTGG + Intergenic
1053933861 9:43132420-43132442 ATTTTTTATAATAAACCATGTGG + Intergenic
1054279834 9:63120818-63120840 ATTTTTTATAATAAACCATGTGG - Intergenic
1054296983 9:63339600-63339622 ATTTTTTATAATAAACCATGTGG + Intergenic
1054395001 9:64644106-64644128 ATTTTTTATAATAAACCATGTGG + Intergenic
1054429648 9:65149306-65149328 ATTTTTTATAATAAACCATGTGG + Intergenic
1054500734 9:65872225-65872247 ATTTTTTATAATAAACCATGTGG - Intergenic
1054729775 9:68689526-68689548 ATTTATGAGATTTATCTTTGTGG - Intergenic
1055503777 9:76927690-76927712 CTTTTTGTGATTAAATCATGTGG - Intergenic
1055530985 9:77183516-77183538 TATTTTGAGATTCATCCATGTGG + Intronic
1055653296 9:78429543-78429565 CTTTTTGGGATTAATCTATTTGG + Intergenic
1056029546 9:82538318-82538340 ATTTTGCAGATTAATCCAATTGG - Intergenic
1057118398 9:92547511-92547533 GTTTTTGAGGTTCATCCATGTGG - Intronic
1057609521 9:96528068-96528090 ATCTTTAAGGTTCATCCATGTGG + Intronic
1058534800 9:105947626-105947648 ATTTTAGAGATTAATAAATCTGG - Intergenic
1058640238 9:107076740-107076762 ATGTTTGTGATAAATCCTTGTGG + Intergenic
1059503002 9:114771731-114771753 GTTTTTGAGATTCATACATGTGG + Intergenic
1059861596 9:118469383-118469405 ATTTTACAGATTAATAAATGGGG + Intergenic
1060061302 9:120462602-120462624 GTTTTTGAGATTCATCCATGTGG - Intronic
1060100651 9:120837954-120837976 TATTTTGAGATTTATCTATGTGG - Intronic
1061642967 9:131974039-131974061 ATTTCAGAGATTAATAAATGTGG - Intronic
1061683582 9:132257203-132257225 TGTTTTAAGATTTATCCATGAGG - Intergenic
1062183085 9:135201495-135201517 AGTTTTGGGATTGTTCCATGTGG + Intergenic
1203453670 Un_GL000219v1:144548-144570 ATTTTTAAGTTTTATCTATGTGG - Intergenic
1186881302 X:13869175-13869197 GTTTCTGAGGTTTATCCATGTGG - Intronic
1187680704 X:21764834-21764856 ATTTTCAAGGTTCATCCATGTGG + Intergenic
1187782702 X:22846473-22846495 ATTGTTGAGAGTAATTCTTGGGG - Intergenic
1187838588 X:23460955-23460977 ATTCTTAAGAATGATCCATGTGG + Intergenic
1187988068 X:24836171-24836193 GTTTGTGAGATTCATCCATGTGG + Intronic
1188222894 X:27561711-27561733 ATTTTTAAGGTTCATACATGTGG + Intergenic
1188792606 X:34422597-34422619 ATTTTAGAGTATATTCCATGTGG - Intergenic
1189405529 X:40719489-40719511 ATTTTCAAGATTGATTCATGTGG - Intronic
1190299972 X:49051511-49051533 GTTTTTGAGGTTCATCCGTGTGG - Intergenic
1190751445 X:53365366-53365388 ATTTTAGAGACCTATCCATGTGG + Intergenic
1191027916 X:55935637-55935659 GTTTTTGAGATTTATCCATGTGG - Intergenic
1192354537 X:70388182-70388204 TATTTTGAGATTCATCCATGTGG + Intronic
1192790415 X:74376986-74377008 ATCCTTGAGAATGATCCATGTGG + Intergenic
1193147181 X:78089336-78089358 ATCCTTGAGAATGATCCATGTGG + Intronic
1193497827 X:82236405-82236427 ATTTTTGGTGTTAAACCATGGGG + Intergenic
1193591877 X:83398481-83398503 ATTTTGGAGAATATTCTATGTGG - Intergenic
1193675351 X:84445582-84445604 ATATATGAGACTAATGCATGGGG + Intronic
1193806055 X:85996390-85996412 ATTTCTGAAATAAGTCCATGAGG + Intronic
1194756585 X:97745721-97745743 ACTTTTGAGTTTAATCCTTTAGG - Intergenic
1195091650 X:101465545-101465567 GTTTGTGAGATTCATCCATTTGG + Intronic
1195097951 X:101524251-101524273 TTCTTTGAGATTATTCCATTTGG - Intronic
1195201228 X:102551711-102551733 ATTTTTGAGATTTATACTAGGGG + Intergenic
1195340275 X:103899722-103899744 AATTTTGCTATGAATCCATGTGG + Intergenic
1196252057 X:113472810-113472832 ATTTGAGAGAATAAACCATGAGG - Intergenic
1198232985 X:134710663-134710685 GTTCTTGAGATCAGTCCATGTGG - Intronic
1198276939 X:135103794-135103816 GTTTTTGAAGTTCATCCATGTGG + Intergenic
1198645021 X:138796963-138796985 ATTTTTGAAATCTATCCATCTGG - Intronic
1199825380 X:151493554-151493576 TATTTTGAGATTAATTCATGTGG + Intergenic
1201746975 Y:17386848-17386870 GTTTTTGAGAAAACTCCATGAGG + Intergenic
1202273489 Y:23093059-23093081 ATTTTTGTGTTTAATCCACGTGG - Intergenic
1202292537 Y:23327623-23327645 ATTTTTGTGTTTAATCCACGTGG + Intergenic
1202426486 Y:24726803-24726825 ATTTTTGTGTTTAATCCACGTGG - Intergenic
1202444303 Y:24943283-24943305 ATTTTTGTGTTTAATCCACGTGG + Intergenic