ID: 923811777

View in Genome Browser
Species Human (GRCh38)
Location 1:237325978-237326000
Sequence CATAATAATGAGAAGGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 324}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923811777 Original CRISPR CATAATAATGAGAAGGATGG TGG Intronic
901450532 1:9333928-9333950 CAAAAAAATGAGAAGGAATGTGG - Intronic
903052365 1:20611299-20611321 CAGAAGAGTAAGAAGGATGGTGG + Intronic
903533230 1:24048154-24048176 TATAATATTTAGAAGCATGGGGG - Intergenic
904111065 1:28126520-28126542 CAGAATAATGTGGAGGAAGGAGG - Intergenic
904868714 1:33602788-33602810 CATAAGAAAGAGAAAGAGGGAGG - Intronic
904944068 1:34186394-34186416 CATGATAATGACAATGATGATGG - Intronic
906711924 1:47937048-47937070 GATAATGATGATAATGATGGTGG - Intronic
906711940 1:47937171-47937193 GATAATGATGATAATGATGGTGG - Intronic
906913027 1:49976862-49976884 CATACTATTTAGAGGGATGGAGG - Intronic
907684224 1:56594303-56594325 CTGAATAACTAGAAGGATGGAGG + Intronic
910699161 1:90053572-90053594 CATAAGAAAGACCAGGATGGGGG + Intergenic
911040973 1:93590552-93590574 CATGATAAGGAGACGGACGGTGG + Intronic
911569337 1:99504289-99504311 GAAAATAATAAAAAGGATGGGGG + Intergenic
912630791 1:111245040-111245062 CTTAAAAATGAGAAAGCTGGGGG - Intergenic
914214475 1:145612731-145612753 GAAAAAGATGAGAAGGATGGTGG - Intronic
914466414 1:147933121-147933143 GAAAAAGATGAGAAGGATGGTGG - Intronic
915242897 1:154536436-154536458 CATAATAATGAGAACACTGGAGG + Intronic
915970928 1:160354603-160354625 CACAAGCATGGGAAGGATGGTGG + Intronic
916230260 1:162534552-162534574 TATAATATTGAGAAGCCTGGAGG + Intergenic
921731032 1:218578178-218578200 CATAGTAATCAGTAGGCTGGGGG + Intergenic
921898524 1:220425780-220425802 CATGATAATGATAACTATGGTGG - Intergenic
922854146 1:228759893-228759915 CTTCATAATGAGTAGGATGAAGG + Intergenic
922867873 1:228875940-228875962 AATAATAAGGAGGAGGAGGGAGG - Intergenic
923811777 1:237325978-237326000 CATAATAATGAGAAGGATGGTGG + Intronic
1063532405 10:6847124-6847146 CATAAAAATGGGAGGGCTGGTGG - Intergenic
1064939448 10:20716427-20716449 CATAATATTTAGAAAAATGGGGG - Intergenic
1066187775 10:33027112-33027134 CAAAATAAGGAGCAAGATGGGGG + Intergenic
1066426535 10:35312461-35312483 CACCATAGTGAGAAGGATGTAGG - Intronic
1066463075 10:35629375-35629397 CATAATAATTAGCAGCATGGTGG + Intergenic
1067515113 10:46933120-46933142 AATAATAATGACAAGGAGGGCGG - Intronic
1067647143 10:48118690-48118712 AATAATAATGACAAGGAGGGCGG + Intergenic
1072270987 10:93776256-93776278 CATAAAAATGTGGAGAATGGGGG - Intronic
1073604398 10:104879597-104879619 CATGCTAATGAAAAAGATGGTGG + Intronic
1073740982 10:106406572-106406594 TAAAAGAAAGAGAAGGATGGAGG + Intergenic
1075909466 10:126111780-126111802 CATAATAAAGAGAAGCACTGGGG + Intronic
1078108206 11:8371862-8371884 AAAAATAAAGAGAAGGAGGGAGG - Intergenic
1078914562 11:15767005-15767027 TATTATAATTAGAAGGATGTGGG + Intergenic
1078954632 11:16177721-16177743 CAATATAATGAGAAGGATCAAGG + Intronic
1078976219 11:16480650-16480672 CATAATAAAAAGAAGGTGGGGGG - Intronic
1079332841 11:19547748-19547770 CATAATAATGACAATGATAGTGG + Intronic
1079450141 11:20593785-20593807 CATTATAAGGATAAGGGTGGGGG + Intergenic
1080177579 11:29384667-29384689 GATAATAATGAGGATGATGATGG + Intergenic
1080983811 11:37437631-37437653 GATAATGATGTGAAGGCTGGAGG + Intergenic
1081563859 11:44244089-44244111 GAGCAGAATGAGAAGGATGGGGG - Intronic
1084581328 11:70025340-70025362 CATGATCATGATAATGATGGTGG + Intergenic
1084738712 11:71123501-71123523 CATCATAAGGAGAGGGAGGGAGG + Intronic
1085793464 11:79516241-79516263 AATAATAAGGAAAGGGATGGAGG - Intergenic
1086070745 11:82796322-82796344 CACAGTAACGAGAAGGAAGGAGG - Intergenic
1086357457 11:86018586-86018608 CATAAGAATGAGATGGATTGAGG + Intronic
1087157790 11:94921848-94921870 CATTATAAGGAGAAGGCAGGAGG - Intergenic
1087779094 11:102284467-102284489 CAAATTAATCAGAAGGATGTAGG - Intergenic
1088803501 11:113329482-113329504 CAATAAAATGAGAAGGAAGGAGG + Intronic
1089153386 11:116382503-116382525 CAGAATATTGAGAAGTGTGGAGG + Intergenic
1089611986 11:119674360-119674382 AATAATAATGATGATGATGGAGG + Intronic
1090451753 11:126812298-126812320 GATAATAATGAGAAGGACTGGGG + Intronic
1092120544 12:6040713-6040735 CATGGGAATGAGGAGGATGGGGG - Intronic
1093246350 12:16742071-16742093 CACAGTTATGAGAATGATGGAGG - Intergenic
1093773900 12:23049920-23049942 AACAAAAATGAGAAGGAAGGGGG + Intergenic
1095154722 12:38838621-38838643 CTTAATCATGAGCAGGAAGGTGG + Intronic
1095232519 12:39757868-39757890 TACAATAAAGAGAAGGATTGAGG + Exonic
1095698947 12:45171203-45171225 CAAAATAATCAGAAGGTTGCTGG + Intergenic
1096221314 12:49829757-49829779 CAAAAAAATGAGAAAGCTGGTGG - Intergenic
1096340337 12:50793061-50793083 CATAATCAGGAGAAGAAAGGAGG - Intronic
1096379454 12:51143659-51143681 CATTTTAAAGAGAAGCATGGAGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097804868 12:63954367-63954389 CTTTTTAATGAGAAAGATGGGGG - Intronic
1098078188 12:66756015-66756037 CATAATTTTTAAAAGGATGGGGG - Intronic
1099120088 12:78678902-78678924 GATAATGATGATAAGGATGATGG - Intergenic
1099559184 12:84150666-84150688 CACAATAATAAAAAGGAAGGAGG - Intergenic
1100292896 12:93234614-93234636 CTCAACAAAGAGAAGGATGGGGG + Intergenic
1100330481 12:93577204-93577226 ACTAATTATGAGAAGGCTGGAGG + Intronic
1101200778 12:102433950-102433972 CATAATGATGCTAAGGAGGGTGG - Intronic
1102369763 12:112372727-112372749 AATAATAATAAGATGGATGTGGG - Intronic
1102669590 12:114606308-114606330 AATAATGATGATAATGATGGTGG - Intergenic
1102792345 12:115657933-115657955 GATAGTAATGAGGAGGAGGGGGG - Intergenic
1102990587 12:117312931-117312953 GGTAACAATGAGAATGATGGTGG - Intronic
1103493672 12:121344250-121344272 CTTAGTAATGAGAGGTATGGAGG + Intronic
1105293365 13:19068621-19068643 GATGATAATGAGGAGGATGATGG - Intergenic
1107725383 13:43293539-43293561 CATAATAATGTTAGGGGTGGTGG - Intronic
1107806875 13:44161532-44161554 CATAATCAGGAGAAGAATGCTGG - Intergenic
1109453422 13:62549509-62549531 CAAAATATTGGAAAGGATGGAGG + Intergenic
1109660964 13:65459461-65459483 CATTATAATGAGAAAAACGGTGG - Intergenic
1109841848 13:67927478-67927500 CATAACAATAAGAATGATGCAGG + Intergenic
1109952786 13:69522570-69522592 AAGAACAATAAGAAGGATGGAGG - Intergenic
1110157505 13:72335550-72335572 TATGTTAATGAAAAGGATGGGGG + Intergenic
1110195942 13:72788580-72788602 GGTAATAAGGAGAAGGATAGTGG + Intronic
1110345878 13:74447336-74447358 CATAACTATGAGATGAATGGAGG + Intergenic
1110855939 13:80296806-80296828 CAAAATAACAAGAAGGAAGGGGG + Intergenic
1111599358 13:90451856-90451878 CATAAAGATGACAAGGATGAAGG + Intergenic
1112999721 13:105620057-105620079 CATAGTAATGAGAAGGACTGGGG + Intergenic
1114127169 14:19742093-19742115 CCAAAAACTGAGAAGGATGGTGG + Intronic
1114712863 14:24795927-24795949 CATTCTTATGAGCAGGATGGTGG - Intergenic
1115097239 14:29651609-29651631 AATAATAATGAGAAGGAGAGAGG - Intronic
1116597913 14:46876671-46876693 CATCATATTGAGAAGGATTCAGG - Intronic
1117487574 14:56213589-56213611 CATTGTAAAGAGAAGAATGGTGG + Intronic
1118768174 14:68923935-68923957 CATAAAAAGGAAAGGGATGGCGG + Intronic
1120266778 14:82260809-82260831 AAAAATAATGAGAAGGAAAGAGG + Intergenic
1120451767 14:84677423-84677445 CATAATAAGCAGAATGATGCTGG - Intergenic
1121586460 14:95066269-95066291 GAAAATAATGAGTATGATGGTGG - Intergenic
1121742021 14:96260635-96260657 CATAATATGGAGGAGGCTGGAGG - Intronic
1121841716 14:97139885-97139907 AATAAGAGTGAGAAAGATGGAGG + Intergenic
1123570625 15:21603732-21603754 CCAAAAACTGAGAAGGATGGTGG + Intergenic
1123606738 15:22039085-22039107 CCAAAAACTGAGAAGGATGGTGG + Intergenic
1124453012 15:29815090-29815112 CTTAATAATGAGCAGTATGTGGG - Intronic
1124834990 15:33187760-33187782 TATAATACTGAGAAGGACTGAGG + Intronic
1126110360 15:45171590-45171612 CTTACTAATGAAATGGATGGGGG - Intronic
1131105478 15:89731287-89731309 CTTCATAAAGAGAAGGATGATGG + Intronic
1132195006 15:99908109-99908131 TCTATTACTGAGAAGGATGGGGG + Intergenic
1202978978 15_KI270727v1_random:330855-330877 CCAAAAACTGAGAAGGATGGTGG + Intergenic
1134374807 16:13662009-13662031 CATAAAAATCAGCAGGATAGTGG - Intergenic
1134541035 16:15065748-15065770 CAAAAGAATTAGAAGGTTGGTGG + Intronic
1134610623 16:15605443-15605465 CATAATCATGATAAGTAGGGTGG - Intronic
1135436487 16:22430292-22430314 CAAAAGAATTAGAAGGTTGGTGG + Intronic
1136263770 16:29101623-29101645 CAAAAGAATTAGAAGGTTGGTGG - Intergenic
1137083546 16:36095781-36095803 CAAAATAAAGAGATGGAGGGAGG - Intergenic
1137362019 16:47827004-47827026 CAAAATATTGACAAGGATGAGGG - Intergenic
1137910250 16:52370752-52370774 CATAATAAGGAGGAAGGTGGTGG + Intergenic
1138000206 16:53270547-53270569 CAAAATAATGTGAAAGATTGGGG + Intronic
1138339882 16:56281626-56281648 CATAATAATGAGCTGGAGTGAGG - Intronic
1138489833 16:57370347-57370369 CATCCTAATGAGATAGATGGGGG + Intergenic
1138563235 16:57814609-57814631 GATAGTAATGATAATGATGGTGG - Intronic
1139730280 16:68938244-68938266 AAGAACAATGAGAAGGTTGGAGG + Intronic
1141847439 16:86620337-86620359 CATCAAGATAAGAAGGATGGGGG - Intergenic
1141881234 16:86861049-86861071 AATGATGATGATAAGGATGGTGG + Intergenic
1144470409 17:15535158-15535180 CATTATAATAAGAAGTATGTGGG - Intronic
1144925931 17:18808514-18808536 CATTATAATAAGAAGTATGTGGG + Intergenic
1147003831 17:37385703-37385725 CATAATAATAATAAAGATGAAGG - Intronic
1147494130 17:40899759-40899781 CATAATAATGGCCAGCATGGTGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149352715 17:55807998-55808020 AATAATGATGATAATGATGGTGG + Intronic
1150766777 17:68008565-68008587 AATAATAATAAGAAGGTTGAAGG + Intergenic
1151295247 17:73180659-73180681 AATAATAATAATAAGCATGGTGG - Intergenic
1152371989 17:79894439-79894461 AATGATAATGAGAGTGATGGTGG - Intergenic
1153847365 18:9062089-9062111 CAGAATAATGAGAAGTATGTGGG - Intergenic
1153898546 18:9592437-9592459 AATTATAATGGGAAGGATCGGGG - Intronic
1156273117 18:35555564-35555586 CAAAATGTGGAGAAGGATGGAGG + Intergenic
1156584638 18:38418339-38418361 GCTAATGCTGAGAAGGATGGAGG + Intergenic
1159133043 18:64302958-64302980 CATCCTAAGAAGAAGGATGGGGG + Intergenic
1159233170 18:65635423-65635445 CCTAAAAATGAGAAGTAGGGTGG + Intergenic
1159234717 18:65656756-65656778 CCTAATAATGGGAGGGAAGGTGG + Intergenic
1160392166 18:78542256-78542278 CAGAATTATGACAAGGTTGGTGG + Intergenic
1162183124 19:8884322-8884344 GATGATAATGAGGATGATGGTGG - Intronic
1163326939 19:16610683-16610705 CATAGAAATTATAAGGATGGTGG - Intronic
1167567340 19:50264913-50264935 GAAAGGAATGAGAAGGATGGAGG + Intronic
925006045 2:443766-443788 CATAATACTGAAATGGATTGAGG + Intergenic
925191689 2:1890008-1890030 CAAAAGAATTAGAAGGATGAAGG + Intronic
926394965 2:12431450-12431472 CAGCATAATGAGAGAGATGGTGG + Intergenic
926538618 2:14146275-14146297 GATAATAATGAAAATGATAGTGG - Intergenic
928289873 2:30027732-30027754 CAAAATCATGAGAAGAATGGGGG + Intergenic
928985527 2:37177505-37177527 CATAATAGAGAGTAGGATGGTGG + Intronic
930484713 2:51997897-51997919 CATATTAATTACATGGATGGTGG - Intergenic
930748231 2:54906573-54906595 CCTTACAATGAGAAGCATGGTGG - Intronic
931654907 2:64502131-64502153 CCTAATAAGGAGTGGGATGGTGG + Intergenic
933632748 2:84675259-84675281 CATAAAAATGAGGGAGATGGAGG - Intronic
935016960 2:99191974-99191996 GATTAGGATGAGAAGGATGGTGG - Intronic
936240360 2:110783020-110783042 CTTAATAATGAGGAGCAGGGAGG + Intronic
936856365 2:116962560-116962582 GATAATAATGACAATGATGATGG - Intergenic
937825939 2:126368644-126368666 CCTAATAATAGGAAGGATGTTGG - Intergenic
937979007 2:127602050-127602072 CATAAAAATGCGAAGGAGAGAGG - Intronic
938992746 2:136646045-136646067 CTCAATAATGAAAATGATGGAGG + Intergenic
939106956 2:137960252-137960274 CTCAATAATGAAAAGGATGGAGG + Intergenic
941063701 2:160876994-160877016 CACAATACTGAGAAGAAAGGGGG + Intergenic
941415998 2:165222440-165222462 CATAATAATGTGATGGGTTGAGG - Intergenic
942725303 2:178999905-178999927 TATAATAATGACTATGATGGTGG - Intronic
942855501 2:180541741-180541763 CAAAGTAATGAGTAGGGTGGGGG - Intergenic
943881488 2:193150702-193150724 CATAAAAATAATAAGGATGAAGG + Intergenic
944306997 2:198189826-198189848 GATAATAATGAGAAGGATGATGG + Intronic
944948522 2:204718636-204718658 CATAACAATGTTGAGGATGGAGG - Intronic
946097596 2:217288972-217288994 GATAATAATGAGAATAATAGTGG - Intronic
946118103 2:217481733-217481755 CATATTAATGGGAAAGAGGGAGG - Intronic
946391830 2:219420786-219420808 CCCAAAAATGAGAAGGATGCAGG - Intronic
948513941 2:238491139-238491161 CATAGTCATGAGTAGGAAGGAGG - Intergenic
1172289681 20:33767027-33767049 CATAAGAATGAGCAGGTAGGTGG + Exonic
1174207041 20:48847805-48847827 TATAGAAATCAGAAGGATGGGGG - Intergenic
1174705377 20:52650001-52650023 CTTAATAATAGGAAGGATGATGG - Intergenic
1175606105 20:60313625-60313647 AATAATAATGAGAAGGAACCAGG + Intergenic
1177108707 21:16996167-16996189 CATAATAAGGAGAGACATGGGGG + Intergenic
1178150948 21:29793110-29793132 CATATTCAGGAGGAGGATGGAGG + Intronic
1178967042 21:37130568-37130590 AATAATAATGAAAATGATGGTGG - Intronic
1179014176 21:37581113-37581135 CATAATTATGACAAGGATTCTGG - Intergenic
1179372540 21:40819690-40819712 CATATTCATGAGAAGAATGTTGG - Intronic
1182233295 22:28855382-28855404 AATATTAATGAGAAGGATAATGG - Intergenic
1183848535 22:40563222-40563244 GATAATAAAGAGAAGGAAGTAGG - Intronic
1183893935 22:40952135-40952157 AATAATAATAAAAAGCATGGTGG + Intronic
949160223 3:873003-873025 CATATTAATGAGATGATTGGTGG - Intergenic
949200130 3:1367333-1367355 CATAGTAAAGAGTAGCATGGTGG - Intronic
949549006 3:5096809-5096831 CCCAACAATGAGAAGGGTGGGGG + Intergenic
949786243 3:7744908-7744930 CATAATAATGTAAAGCATGTTGG + Intergenic
949929444 3:9067147-9067169 GATAATAATGATGATGATGGTGG - Intronic
950327817 3:12129142-12129164 GATAATATAGAGAATGATGGAGG + Intronic
951173808 3:19575773-19575795 CATAATAACTAGAAGAATGATGG - Intergenic
951388639 3:22074643-22074665 CATAAAAATTTGAAGAATGGAGG - Intronic
951619700 3:24587615-24587637 CATAATTTTGAAAATGATGGTGG + Intergenic
951679936 3:25284060-25284082 CAGCAAAATGAGAAGGAGGGAGG - Intronic
951703083 3:25515721-25515743 TATGATAATGAGAAGAATGGTGG + Intronic
952157292 3:30657033-30657055 CATTAAAATGAGAAGTCTGGAGG - Intronic
952413765 3:33072297-33072319 CTTAAAAAGGAAAAGGATGGGGG - Intronic
954725725 3:52607802-52607824 AGAAATAAAGAGAAGGATGGAGG - Intronic
955625240 3:60911418-60911440 CATGATGATGAAAATGATGGTGG - Intronic
957259690 3:77884929-77884951 AATAATCATGAGATGGAAGGTGG + Intergenic
958205758 3:90388448-90388470 CATAAAAACTAGAAGGAAGGAGG - Intergenic
958662992 3:97095495-97095517 CATAATTTTGAAAAGGAAGGTGG - Intronic
958854845 3:99372566-99372588 CATTCAAATGAGAAGGATGTAGG - Intergenic
959099593 3:101995454-101995476 CATATTATTGGGCAGGATGGTGG + Intergenic
959839298 3:110955865-110955887 CAGAAGATTAAGAAGGATGGAGG - Intergenic
961112871 3:124299745-124299767 TATGATAATGATAAGGATGGAGG + Intronic
961315513 3:126032772-126032794 CATTCTAATGTGATGGATGGGGG + Intronic
961383266 3:126509612-126509634 CATAATCATGTGCATGATGGCGG + Exonic
962591389 3:136892961-136892983 CATATGAATGATAAGGGTGGTGG - Intronic
966266944 3:178057627-178057649 CATAATAATAAGAGGGTTGGTGG + Intergenic
967507432 3:190268851-190268873 CATAAGAATGAGAAGTATATGGG + Intergenic
971640625 4:29127542-29127564 AATAATAATGATAACGATGATGG - Intergenic
972589867 4:40474870-40474892 CATCATAATGAGAAGGGAGAAGG + Intronic
975112304 4:70641705-70641727 CAGAAAAATTAGGAGGATGGAGG + Intronic
975430999 4:74290746-74290768 AAAAGTAATGAGGAGGATGGTGG - Intronic
975693868 4:76992742-76992764 CATAATAAAGACAATGATGGAGG + Intronic
975766953 4:77678578-77678600 CAAAATAATGAGAAAGATAAAGG + Intergenic
976933081 4:90592662-90592684 CAAAATAATGAGAAGCATATGGG - Intronic
977076839 4:92464195-92464217 CAAAAGAATGAGAAAGATAGTGG + Intronic
978609292 4:110519636-110519658 AATAATAATGATGATGATGGTGG - Intronic
978776357 4:112510169-112510191 GAGAATAATAAGAAGCATGGGGG + Intergenic
978850666 4:113332107-113332129 CAGAAGAAGGAGAAGAATGGGGG - Intronic
979561326 4:122105194-122105216 CCTAGTGAGGAGAAGGATGGAGG + Intergenic
980650808 4:135712287-135712309 CATTATAATGAGAAAAATGCCGG - Intergenic
980801219 4:137752680-137752702 CATGATAAGGGGAAGGTTGGAGG + Intergenic
980912564 4:139006891-139006913 CAAAAAAAGGAGGAGGATGGGGG - Intergenic
980951725 4:139385759-139385781 CAGAATAATGTGGAGGTTGGGGG - Intronic
981037631 4:140188819-140188841 AATAATAACAATAAGGATGGTGG + Intergenic
981363903 4:143879005-143879027 AAAAATAATGAGAAGAAAGGAGG + Intronic
981374631 4:143999780-143999802 AAAAATAATGAGAAGAAAGGAGG + Intronic
982274280 4:153623259-153623281 GATGATTATGACAAGGATGGAGG - Intronic
982816759 4:159895433-159895455 CATTTTAATGAGGAGGATTGAGG - Intergenic
983332550 4:166349247-166349269 TATAATCAATAGAAGGATGGAGG - Intergenic
983373220 4:166891113-166891135 CAAAATAAAGGGATGGATGGAGG - Intronic
984002416 4:174266258-174266280 AATAATAATGGGGAGGTTGGAGG + Intronic
984478254 4:180264998-180265020 CATCATAATGGGCAGGGTGGTGG - Intergenic
985019365 4:185671043-185671065 CCTACGACTGAGAAGGATGGAGG + Intronic
986122116 5:4849830-4849852 GATAATGATGATAATGATGGTGG + Intergenic
988523111 5:31963879-31963901 CATGGCATTGAGAAGGATGGGGG - Intronic
989325025 5:40182181-40182203 AATAATAATGATAATAATGGTGG + Intergenic
989435516 5:41408871-41408893 CTAAATAATAAGAAAGATGGGGG + Intronic
989667935 5:43878333-43878355 GATAATAATGAGAATAATGATGG + Intergenic
990631579 5:57676118-57676140 CAAAATAAATAGAGGGATGGGGG + Intergenic
992065256 5:73101443-73101465 CCTATTAATGAAATGGATGGGGG + Intergenic
992426399 5:76662312-76662334 CAGGATAATGAGAGGAATGGAGG - Intronic
993579796 5:89646155-89646177 CAAAATAAAGTGAAGGAGGGGGG - Intergenic
993832859 5:92780786-92780808 CATAATAATCATAATGATGATGG - Intergenic
993875010 5:93296191-93296213 CATAATAATTTGAAGCATGAAGG + Intergenic
994160046 5:96547346-96547368 CATAAGAACCAGAAGGAAGGAGG + Intronic
994330990 5:98506335-98506357 AATAAAAATGAGAAAAATGGAGG + Intergenic
995345694 5:111114310-111114332 GAGAAAAATGAGAAGGAAGGTGG + Intronic
996137578 5:119863403-119863425 CATAATAATAAGGAGGATGTTGG + Intergenic
996694045 5:126373794-126373816 CATAAGACTGAGAAGGAGCGTGG + Intronic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
998394138 5:141807187-141807209 CTTAAGACAGAGAAGGATGGAGG + Intergenic
998771935 5:145555747-145555769 CAAGAAAAAGAGAAGGATGGAGG + Intronic
999683048 5:154077521-154077543 GGTAATAATGAAAATGATGGTGG + Intronic
999969452 5:156844704-156844726 GATAGTAAGGAGAAAGATGGAGG + Intergenic
1000827115 5:166058700-166058722 TATCAGGATGAGAAGGATGGAGG - Intergenic
1000925413 5:167187800-167187822 CTTTATAATGGGAAGGAGGGTGG - Intergenic
1000928133 5:167218745-167218767 AATAATAATGAGAAGTATAATGG + Intergenic
1000991137 5:167913110-167913132 CATAATGTTGAGAACCATGGGGG + Intronic
1001750993 5:174131312-174131334 CATAAGAATCAGCAGGAAGGTGG + Intronic
1001771417 5:174299890-174299912 CATGACAATGATAATGATGGTGG + Intergenic
1002129041 5:177068243-177068265 CAAAATTATGAGAAAAATGGAGG - Intronic
1002316626 5:178348286-178348308 CAAAATAATGAGAAGAAAGCAGG - Intronic
1002939792 6:1705896-1705918 CACAGCAATGAGAAGGGTGGCGG + Intronic
1004306060 6:14502829-14502851 CATATTAAGTAGATGGATGGAGG - Intergenic
1004915313 6:20326800-20326822 CATTATAAGGTGAAGCATGGTGG + Intergenic
1005827617 6:29644247-29644269 AATAATTATAAGTAGGATGGGGG + Intergenic
1005866442 6:29941276-29941298 CTGAAGGATGAGAAGGATGGAGG + Exonic
1005874155 6:29998615-29998637 CACAATAATGATGAGGTTGGGGG + Intergenic
1006710848 6:36069277-36069299 AAAAATAATGAACAGGATGGGGG - Intronic
1007019136 6:38501774-38501796 CATAATAAAGAGAAGACTGCTGG - Intronic
1008424621 6:51342687-51342709 TATAATAAAGAGATGGAAGGAGG + Intergenic
1008811088 6:55500120-55500142 CATAAAAGGGAGAGGGATGGTGG + Intronic
1008962502 6:57279977-57279999 CATAATAATGAGAAGGGAAGAGG + Intergenic
1009227494 6:61032488-61032510 TATAATAATCAGAAGGAAAGAGG - Intergenic
1010189071 6:73176074-73176096 CATAAGAATGAGCAGGAATGTGG + Intronic
1010669298 6:78668180-78668202 CATAATAAGGAGGATGGTGGTGG + Intergenic
1012280232 6:97319645-97319667 CGTAAGAATAAAAAGGATGGCGG - Intergenic
1015497708 6:133897996-133898018 CATGCTAATGAGATGGCTGGTGG - Intergenic
1016169636 6:140995376-140995398 CATAATAATGGCAGTGATGGAGG - Intergenic
1016695702 6:146992379-146992401 CACAATAATGAAAAAGGTGGGGG + Intergenic
1017225021 6:152010955-152010977 AACAATAATGAGAAGGAGGTAGG - Intronic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1019862603 7:3674304-3674326 CATGGTAATGAGAAGGAAGGAGG + Intronic
1020921057 7:14264849-14264871 CAAAATCATGAGAAAAATGGGGG + Intronic
1020975256 7:14998694-14998716 CATACCAATGGGAAGGATGATGG - Intergenic
1023279900 7:38558571-38558593 AATAATGATGGGAAGGAGGGAGG + Intronic
1023589524 7:41766270-41766292 CTCAATAATGATAAAGATGGAGG - Intergenic
1024237456 7:47409090-47409112 GAAAATAATGAGGAGGAAGGAGG + Intronic
1027589284 7:80097190-80097212 AATAACAAGGAGCAGGATGGTGG + Intergenic
1030078479 7:105757289-105757311 GATAATCACAAGAAGGATGGAGG + Intronic
1030080620 7:105774651-105774673 CTTATTAATGAGAAGGCTGCGGG - Intronic
1030100728 7:105942997-105943019 TATAATAATGAGAATGCTGGAGG + Intronic
1030623441 7:111817403-111817425 CATAATAACAGGAAGGAAGGTGG - Intronic
1032529432 7:132608159-132608181 GATAGTGATGAGAATGATGGCGG - Intronic
1032954528 7:136955174-136955196 CAAAATCATGAGAAAGAAGGAGG - Intronic
1034310000 7:150079090-150079112 CATAAAAATGGGAAAAATGGAGG - Intergenic
1034796846 7:154021531-154021553 CATAAAAATGGGAAAAATGGAGG + Intronic
1035255805 7:157626394-157626416 CAAAATGTAGAGAAGGATGGCGG - Intronic
1035579317 8:730461-730483 CATCATAATGAAAAGAGTGGCGG - Intronic
1038770472 8:30474419-30474441 TCTAAAAATGTGAAGGATGGGGG - Intronic
1040816933 8:51518764-51518786 CATATTAATGAGAAAGAAAGTGG + Intronic
1041722364 8:60987734-60987756 CATTATCATGATAAGCATGGAGG + Intergenic
1042660662 8:71150705-71150727 GATAATAATGATGATGATGGGGG - Intergenic
1043084859 8:75816697-75816719 GAAAATATTGAGAAGTATGGTGG - Intergenic
1044161923 8:88929621-88929643 TATAATAACGACAAGGATGTTGG + Intergenic
1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG + Intronic
1045578668 8:103453962-103453984 AAGAATAAGGTGAAGGATGGTGG + Intergenic
1045750230 8:105475289-105475311 CATAACAATGAGAAGCAGAGAGG - Intronic
1046442301 8:114273244-114273266 AATAATAATGACAATGATAGAGG + Intergenic
1046827452 8:118706924-118706946 AATAATAAGGACAAGGTTGGGGG - Intergenic
1047327060 8:123849919-123849941 AATATGAATGAGAAGAATGGTGG + Intergenic
1048840350 8:138560265-138560287 GATGAGAATGAGAAGGATAGAGG + Intergenic
1049276458 8:141722492-141722514 TTTAATAAGGAGAGGGATGGGGG + Intergenic
1050654542 9:7812185-7812207 CACAAAGATGAGCAGGATGGAGG + Intronic
1051763204 9:20492150-20492172 ATTAATAATGACAAAGATGGAGG - Intronic
1051845821 9:21450013-21450035 CAGAATATTGGGAAGGATGGGGG + Intergenic
1052048008 9:23817353-23817375 CTTTATGAAGAGAAGGATGGGGG - Intronic
1052406346 9:28065808-28065830 AATGAGAATGAGAATGATGGTGG + Intronic
1052968797 9:34363737-34363759 CATAATCCTGAGCAGGATGGCGG - Intergenic
1054976225 9:71149067-71149089 AATTGTAAAGAGAAGGATGGCGG + Intronic
1055058975 9:72049341-72049363 CAACATAATCACAAGGATGGAGG - Intergenic
1055160786 9:73125477-73125499 CCTAAGGATGAGAAGGATGAAGG - Intergenic
1055353253 9:75411519-75411541 AATAATTAAGAGATGGATGGAGG + Intergenic
1055652026 9:78415502-78415524 TAGAATCATGAGGAGGATGGAGG + Intergenic
1056002564 9:82232420-82232442 CACTATAATGAGAAGCAAGGGGG + Intergenic
1056874152 9:90311917-90311939 CATAGAAATGAGAAGGTTGTGGG - Intergenic
1057920377 9:99092230-99092252 CATTATGATGAGAAGGCTCGGGG + Intergenic
1058135023 9:101297553-101297575 TCTTATAATGAGAAGGTTGGGGG - Intronic
1058400540 9:104613163-104613185 CAGAAGGAAGAGAAGGATGGAGG + Intergenic
1060844336 9:126823679-126823701 AATAATAAAAAGTAGGATGGGGG - Intronic
1060962883 9:127693605-127693627 GATCAGAATGAGAATGATGGGGG - Intronic
1187264589 X:17719162-17719184 AGGAATAATGAGAAGGAAGGAGG + Intronic
1188344611 X:29048266-29048288 CATATTTATTAGTAGGATGGTGG - Intronic
1188437970 X:30184596-30184618 GAGAATAATTAGTAGGATGGAGG + Intergenic
1189564701 X:42229560-42229582 CATTATTATGAGATGGATTGGGG + Intergenic
1190545322 X:51519638-51519660 CTAAACAATGAGCAGGATGGTGG - Intergenic
1192869861 X:75175086-75175108 CATAAAAATGGGAAGGAGAGGGG - Intergenic
1193317020 X:80076560-80076582 CCTAATAATGAGCAGGGTTGTGG + Intergenic
1195274863 X:103272163-103272185 CATATTATTCAGAAAGATGGAGG + Intergenic
1196335934 X:114534462-114534484 TACAATAATGAAAAGGATAGTGG + Intergenic
1196580533 X:117374161-117374183 CATAAGAATGACAAGGTTTGTGG - Intergenic
1197072783 X:122320867-122320889 CATAGAAATGAGTAGAATGGTGG + Intergenic
1198148280 X:133881200-133881222 CATAATACTGATGAGGATTGTGG - Intronic
1198546409 X:137697108-137697130 AATAATAATGATAATTATGGTGG - Intergenic
1199503416 X:148535185-148535207 CATAATAACCACAATGATGGTGG - Intronic