ID: 923812171

View in Genome Browser
Species Human (GRCh38)
Location 1:237330806-237330828
Sequence CTCCTAAGGTAAGCTGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 211}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923812171 Original CRISPR CTCCTAAGGTAAGCTGGGTC TGG Intronic
900845793 1:5099376-5099398 CTCATTAGTGAAGCTGGGTCGGG + Intergenic
906092748 1:43196460-43196482 CTCAGAAGCTAAGCAGGGTCAGG + Intronic
907061432 1:51430142-51430164 TTCCTAAGATAAGCAGAGTCAGG - Intronic
909280735 1:73749560-73749582 CTCGGAAGCTAAGCAGGGTCGGG - Intergenic
909533265 1:76705174-76705196 CTCCAGAGGTAAGCTAGGGCTGG + Intergenic
909632315 1:77779941-77779963 CTCAGAAGCTAAGCAGGGTCGGG + Intronic
914756223 1:150562907-150562929 CTCACAAGTTCAGCTGGGTCAGG + Intergenic
916317680 1:163468540-163468562 CTCGAAAGCTAAGCAGGGTCAGG - Intergenic
917256125 1:173118221-173118243 ATACTCAGGTAATCTGGGTCTGG - Intergenic
917866859 1:179204453-179204475 ATACTAAGATGAGCTGGGTCTGG + Intronic
918274913 1:182944425-182944447 CTCGGAAGCTAAGCAGGGTCGGG - Intronic
920366251 1:205449819-205449841 CTCCCAAGGGATGCTGGGCCAGG + Intronic
921244744 1:213225931-213225953 CACCTCATGTAAGCTGGGTGTGG + Intronic
922539601 1:226408658-226408680 CCCCTGAGGGCAGCTGGGTCCGG + Intergenic
922831891 1:228558339-228558361 CTCGGAAGCTAAGCAGGGTCGGG - Intergenic
922832371 1:228610321-228610343 CTCGGAAGCTAAGCAGGGTCGGG - Intergenic
922832931 1:228612562-228612584 CTCGGAAGCTAAGCAGGGTCGGG - Intergenic
922833492 1:228614803-228614825 CTCGGAAGCTAAGCAGGGTCGGG - Intergenic
922834052 1:228617044-228617066 CTCGGAAGCTAAGCAGGGTCGGG - Intergenic
922834609 1:228619285-228619307 CTCGGAAGCTAAGCAGGGTCGGG - Intergenic
922835161 1:228621500-228621522 CTCGGAAGCTAAGCAGGGTCGGG - Intergenic
922835720 1:228623720-228623742 CTCGGAAGCTAAGCAGGGTCGGG - Intergenic
922836278 1:228625962-228625984 CTCGGAAGCTAAGCAGGGTCGGG - Intergenic
922836836 1:228628201-228628223 CTCGGAAGCTAAGCAGGGTCGGG - Intergenic
922837395 1:228630443-228630465 CTCGGAAGCTAAGCAGGGTCGGG - Intergenic
922837956 1:228632684-228632706 CTCGGAAGCTAAGCAGGGTCGGG - Intergenic
922838514 1:228634924-228634946 CTCGGAAGCTAAGCAGGGTCGGG - Intergenic
922839072 1:228637149-228637171 CTCGGAAGCTAAGCAGGGTCGGG - Intergenic
922839632 1:228639390-228639412 CTCGGAAGCTAAGCAGGGTCGGG - Intergenic
922840192 1:228641621-228641643 CTCGGAAGCTAAGCAGGGTCGGG - Intergenic
922840752 1:228643862-228643884 CTCGGAAGCTAAGCAGGGTCGGG - Intergenic
922841316 1:228646093-228646115 CTCGGAAGCTAAGCAGGGTCGGG - Intergenic
923812171 1:237330806-237330828 CTCCTAAGGTAAGCTGGGTCTGG + Intronic
924251150 1:242134305-242134327 CTCTGAAGCTAAGCAGGGTCAGG + Intronic
1062788089 10:282060-282082 CTCGGAAGCTAAGCAGGGTCGGG - Intronic
1062839020 10:655333-655355 CTCTTTAGCTCAGCTGGGTCCGG - Intronic
1063397004 10:5697642-5697664 CTCCAAATGTAATCTGGTTCAGG - Intronic
1063494966 10:6498606-6498628 CTCCTATTCTAAGCTGGGTCAGG + Intronic
1072217885 10:93303233-93303255 CTCAGAAGCTAAGCAGGGTCAGG + Intergenic
1072566298 10:96619419-96619441 CTCTGAGGGTAAGCAGGGTCGGG + Intronic
1073903557 10:108250683-108250705 CTCCTTAGCTCAGCTAGGTCTGG - Intergenic
1078161664 11:8845304-8845326 CTCAAAAGCTAAGCAGGGTCAGG + Intronic
1079315192 11:19401916-19401938 CTCAGAAGCTAAGCAGGGTCGGG - Intronic
1079631950 11:22688394-22688416 CTCGGAAGCTAAGCGGGGTCGGG + Intronic
1080267162 11:30413533-30413555 CTTTCAAGGTAAGCTGAGTCAGG - Intronic
1081367904 11:42258929-42258951 ATACTAAGGTAAGCTGGGCAAGG - Intergenic
1083771608 11:64870769-64870791 TTCCAAAGGGCAGCTGGGTCCGG - Intronic
1083808176 11:65087426-65087448 CTGCTAAGGTACACAGGGTCAGG + Exonic
1083878699 11:65537873-65537895 CTAGTCAGGTGAGCTGGGTCTGG + Exonic
1085146067 11:74198789-74198811 CTCGGAAGCTAAGCAGGGTCAGG - Intronic
1086343802 11:85874940-85874962 CTCCTTAGCTCAGCTAGGTCTGG + Intronic
1089699609 11:120236578-120236600 CTCCTAAGCTAAACAGGGACAGG + Intergenic
1090174494 11:124636502-124636524 CTCGGAAGCTAAGCAGGGTCGGG + Exonic
1092899657 12:13046195-13046217 CTCGGAAGCTAAGCAGGGTCGGG + Intronic
1093331685 12:17851103-17851125 CTCCTTAGCTCAGCTAGGTCTGG - Intergenic
1094315345 12:29133450-29133472 CTCCTTAGCTCAGCTAGGTCTGG + Intergenic
1096058699 12:48678030-48678052 CTCAGAAGCTAAGCAGGGTCAGG + Intronic
1097628273 12:62028240-62028262 CTCCTGTGGTAAGCTGAGTTAGG + Intronic
1101323802 12:103697115-103697137 CTCCTCAGGGAAGCTGGCCCTGG + Intronic
1101370515 12:104125279-104125301 CTCGGAAGCTAAGCAGGGTCGGG + Intronic
1103758642 12:123232230-123232252 CTGCTAAGGTAATCCGGATCCGG + Intronic
1105050651 12:133047563-133047585 CTCGGAAGCTAAGCAGGGTCGGG - Intronic
1105296005 13:19088526-19088548 CTCGGAAGCTAAGCAGGGTCAGG + Intergenic
1105697188 13:22900507-22900529 CTCCTCAGGAAGGCTGGGGCTGG + Intergenic
1106408936 13:29497596-29497618 CTCCTATGATAAGCATGGTCTGG + Intronic
1107268672 13:38588569-38588591 CTCTTAAAGTAAGGTGGGTGGGG + Intergenic
1113045971 13:106155425-106155447 CTCACAAGCTAAGCAGGGTCGGG - Intergenic
1114177530 14:20336416-20336438 CTACTAAGGTAGGCTGAGTCGGG + Intergenic
1114857117 14:26461636-26461658 CTCCTAATGTAGGCTGGGCTTGG + Intronic
1116812473 14:49552675-49552697 CTCAGAAGATAAGCAGGGTCAGG + Intergenic
1116835523 14:49766509-49766531 CTGGAAAGGCAAGCTGGGTCTGG + Intergenic
1119482964 14:74970762-74970784 CTCCTAAGGGAAGGTGAATCTGG - Intergenic
1119529922 14:75352910-75352932 CTCCTAAGCTAAGCAGGGTCGGG - Intergenic
1119562777 14:75604216-75604238 CTCGGAAGCTAAGCAGGGTCGGG + Intronic
1119745076 14:77038267-77038289 CTACTAGGGTTAGCTGGGGCCGG + Intergenic
1119796621 14:77403929-77403951 CTCAGAAGCTAAGCAGGGTCGGG - Intronic
1119890356 14:78177856-78177878 CTCGGAAGCTAAGCAGGGTCTGG - Intergenic
1121166218 14:91803908-91803930 CTCAGAAGCTAAGCAGGGTCGGG - Intronic
1123198128 14:106636715-106636737 CTCGGAAGCTAAGCAGGGTCGGG + Intergenic
1125517645 15:40331593-40331615 CTCGTAAGCTAAGCAGGGTCAGG - Intronic
1128949260 15:71858613-71858635 CTCAGAAGCTAAGCAGGGTCAGG + Intronic
1129310099 15:74701397-74701419 CTCCTCAGATTAGCTGGGTGTGG + Intergenic
1129937148 15:79460242-79460264 CTCCAAAGGTGGGCCGGGTCTGG - Intronic
1130968173 15:88712254-88712276 CTCCTGAGGAAGGCTGTGTCTGG - Intergenic
1132316191 15:100892091-100892113 CTCTGAAGGTTAGCTGGCTCTGG - Intronic
1132901407 16:2256770-2256792 CAACCAAGGGAAGCTGGGTCTGG + Intronic
1133695474 16:8258622-8258644 TTCCCAAGGTGAGCTGGATCTGG - Intergenic
1133857607 16:9564432-9564454 CTCAGAAGCTAAGCAGGGTCGGG - Intergenic
1135298063 16:21300730-21300752 CTCCGAAGTTAAGCTTTGTCAGG - Intronic
1135435871 16:22426237-22426259 GTCCTCAGGGAAGCTGGGGCTGG - Intronic
1135959298 16:26982475-26982497 CTCCCTAGGTAGGCTGGGTGTGG - Intergenic
1137056512 16:35748830-35748852 CCCAGAAGGTAAGCAGGGTCGGG + Intergenic
1138776686 16:59731397-59731419 CTCAGAAGCTAAGCAGGGTCGGG + Intronic
1139345667 16:66301852-66301874 CTCAGAAGCTAAGCAGGGTCGGG + Intergenic
1139706209 16:68742520-68742542 CTCGGAAGCTAAGCAGGGTCGGG + Intronic
1142045081 16:87920067-87920089 GTCCTCAGGGAAGCTGGGGCTGG - Intronic
1143243454 17:5463674-5463696 CTCCTAGGGGAAACTGGCTCTGG - Exonic
1143396319 17:6600986-6601008 CTCCGAAGCTAAGCAGGGTTGGG - Intronic
1143983013 17:10886324-10886346 CTCAGAAGCTAAGCAGGGTCAGG - Intergenic
1145824981 17:27870064-27870086 CTCCTTAGCTCAGCTAGGTCTGG - Intronic
1147189823 17:38731855-38731877 CTCGGAAGCTAAGCAGGGTCAGG - Intronic
1148563606 17:48620252-48620274 CTCCTGAGGTAGGCGGGCTCGGG + Intronic
1148729289 17:49821783-49821805 TTTCTAAGGTAAGCAGGATCTGG + Exonic
1150847481 17:68674486-68674508 CTCCTTAGCTCAGCTAGGTCCGG + Intergenic
1153838707 18:8987292-8987314 CTCCTAGGGGAATCTGGGTCTGG - Intergenic
1155229876 18:23762431-23762453 ATACTAAGGTTAGCTGGGTGTGG + Intronic
1156579011 18:38353812-38353834 TTCATAAGGCAAGCTGGGCCTGG + Intergenic
1159568460 18:70083781-70083803 CTTAGAAGGTAAGCTGGGTGTGG + Intronic
1159794729 18:72827862-72827884 CTCCAAAGGGAAGCTGGGCTTGG + Intronic
1160831333 19:1106087-1106109 CTCCTGGGGTAAGATGGCTCTGG + Intronic
1164002307 19:21113181-21113203 CTCGGAAGCTAAGCAGGGTCGGG - Intronic
1165827016 19:38711354-38711376 CTCAGAAGGTGAGCTGGGCCAGG + Intronic
1168619563 19:57867306-57867328 CTCGGAAGCTAAGCAGGGTCGGG + Intronic
1168688647 19:58363501-58363523 CTCAGAAGCTAAGCAGGGTCGGG + Intergenic
926294860 2:11561714-11561736 CTCAGAAGCTAAGCAGGGTCGGG - Intronic
926723833 2:15982493-15982515 CTCCTTAGATAAGCAGGGTTGGG + Intergenic
928049428 2:27974079-27974101 CACCCAAGATAATCTGGGTCTGG - Intronic
928865348 2:35911052-35911074 CTCCTGAGGTAAGTTGTGCCAGG - Intergenic
929169776 2:38920138-38920160 CTCCTAAGGCATGCTGGTACAGG - Intronic
931129788 2:59322223-59322245 CTCGGAAGCTAAGCAGGGTCGGG + Intergenic
931302937 2:60998795-60998817 CTCAAAAGCTAAGCAGGGTCAGG + Intronic
933031260 2:77331645-77331667 CTCCTATGTTAATCTGGGCCTGG + Intronic
933377302 2:81496262-81496284 CTCGGAAGCTAAGCAGGGTCAGG - Intergenic
935139388 2:100339313-100339335 CCCCCAAAGTAAGCTGGGTCCGG - Intergenic
936848010 2:116860872-116860894 CTCCTAAATTAAGTTAGGTCAGG - Intergenic
939610197 2:144300741-144300763 CTACTAAGGGAAGCTGGGATAGG + Intronic
941200043 2:162496638-162496660 CTCCTTAGCTCAGCTAGGTCTGG - Intronic
942286382 2:174421590-174421612 CATCTAAGGAAAGCTGGGCCAGG - Intronic
1170874473 20:20237294-20237316 CTCGTAAGGTACCCTGAGTCTGG - Intronic
1171943783 20:31356912-31356934 CTCAGAAGCTAAGCAGGGTCAGG + Intergenic
1171967604 20:31542319-31542341 CCTCTAAGGTCAGCTGGGTGGGG - Intronic
1172035572 20:32008391-32008413 CTCGGAAGCTAAGCAGGGTCGGG + Intergenic
1174404448 20:50294451-50294473 CTTCTAGGGGAAGCTGGCTCGGG - Intergenic
1181516290 22:23415438-23415460 CTCCCAAGTGAAGCGGGGTCAGG + Intergenic
1181595422 22:23911466-23911488 CTCAGAAGCTAAGCAGGGTCTGG - Intergenic
1182114148 22:27745368-27745390 CTCCTAATCCAAGCTGGGCCAGG + Intergenic
1184731878 22:46375071-46375093 CTCTTGAGGTAAGAGGGGTCTGG + Intronic
952805048 3:37341692-37341714 CTCAGAAGTTAAGCAGGGTCAGG + Intronic
953159770 3:40407623-40407645 CTCCTTAGATGAGCTGGGGCTGG - Intronic
954421171 3:50419824-50419846 CTCAAAAGCTAAGCAGGGTCAGG + Intronic
955366020 3:58310772-58310794 CTGCAAAGATAAGCTGGGTGTGG + Intronic
956401314 3:68883000-68883022 CTCAGAAGCTAAGCAGGGTCGGG + Intronic
956673252 3:71711203-71711225 CTCCTAAGGTTTGATGGGACAGG - Intronic
961392718 3:126564613-126564635 CTCAGAAGCTAAGCAGGGTCAGG - Intergenic
963949928 3:151188142-151188164 CTCGGAAGCTAAGCAGGGTCGGG + Intronic
966459625 3:180161912-180161934 CTCGGAAGCTAAGCAGGGTCGGG - Intergenic
967763153 3:193247584-193247606 CTCCTTAGCTCAGCTAGGTCTGG - Intronic
969206851 4:5653706-5653728 GTACTAAGGGAAACTGGGTCTGG + Intronic
973959702 4:56097433-56097455 CTCGGAAGCTAAGCAGGGTCGGG + Intergenic
974375411 4:61070346-61070368 CTCTAAAGGTAGGCTGGGGCTGG - Intergenic
975216263 4:71759551-71759573 CTCAGAAGCTAAGCAGGGTCAGG - Intronic
977242039 4:94584586-94584608 CTCCTAAAGAAAGCTGTGTGTGG - Intronic
979602685 4:122603721-122603743 CTCCTTAGCTCAGCTAGGTCTGG - Intergenic
984262349 4:177457163-177457185 CTCAGAAGCTAAGCAGGGTCGGG - Intergenic
986629847 5:9760949-9760971 CTCCGAAGCTAAGCAGGGTTGGG + Intergenic
987652901 5:20767490-20767512 CTCCTTAGCTCAGCTAGGTCTGG + Intergenic
988310002 5:29544234-29544256 CTCCTACTGTCTGCTGGGTCAGG - Intergenic
988742662 5:34093994-34094016 CTCCTTAGCTCAGCTAGGTCTGG - Intronic
988812842 5:34802322-34802344 CTCGGAAGCTAAGCAGGGTCGGG + Intronic
991155052 5:63424458-63424480 ATACAAAGGTTAGCTGGGTCAGG + Intergenic
992242165 5:74783355-74783377 CTCTTAAGGAAAGATGGGGCAGG + Intronic
992910656 5:81393559-81393581 CTCCCAAAGTCAGCTGGGCCTGG + Intronic
994690739 5:103016470-103016492 CTCCAAAGGTGCCCTGGGTCTGG - Intronic
997633331 5:135386323-135386345 CTCCTAAGGTCAATTGGGCCTGG + Intronic
999473335 5:151875627-151875649 CTCTGAAGCTAAGCAGGGTCAGG - Intronic
999879479 5:155845480-155845502 CTCGGAAGCTAAGCAGGGTCGGG + Intergenic
1001027913 5:168239606-168239628 CTCATAAGCTAAGCAGGATCAGG - Intronic
1003250822 6:4428006-4428028 CTCGGAAGCTAAGCAGGGTCGGG + Intergenic
1003682319 6:8268290-8268312 CTCCTACGGTGGCCTGGGTCAGG + Intergenic
1005073570 6:21885569-21885591 CTCCCAGGGTCAGCTGGGTCAGG - Intergenic
1006168254 6:32078560-32078582 CTCAGAAGCTAAGCAGGGTCAGG - Intronic
1007866645 6:44977574-44977596 CTCACAAGCTAAACTGGGTCAGG + Intronic
1009620203 6:66065140-66065162 CTCAGAAGCTAAGCAGGGTCAGG + Intergenic
1010438597 6:75865270-75865292 CTCAAAAGCTAAGCAGGGTCAGG - Intronic
1013397165 6:109753190-109753212 CTCGGAAGCTAAGCAGGGTCGGG - Intronic
1014653404 6:124069646-124069668 CTCCACAGGAAAGCTGGGACTGG - Intronic
1015681434 6:135813141-135813163 CTCCTTAGCTCAGCTAGGTCTGG + Intergenic
1016378569 6:143449843-143449865 CTCGGAAGCTAAGCAGGGTCAGG + Intronic
1017349288 6:153420481-153420503 CTCGGAAGCTAAGCAGGGTCGGG + Intergenic
1018590061 6:165409605-165409627 CTCGGAAGCTAAGCAGGGTCGGG + Intronic
1022791503 7:33693621-33693643 CTCCCAAGGTGATCTGGGGCTGG + Intergenic
1024580405 7:50796260-50796282 CTCCTCAGGTATTCTGGGGCAGG - Intergenic
1026656559 7:72261716-72261738 CTGCTAAAATAAGCTGGGTGTGG - Intronic
1029982971 7:104896365-104896387 CTCAGAAGCTAAGCAGGGTCAGG + Intronic
1030860003 7:114613841-114613863 CTCGGAAGCTAAGCAGGGTCAGG - Intronic
1031365617 7:120897252-120897274 CTTGAAAGCTAAGCTGGGTCAGG - Intergenic
1031372146 7:120981488-120981510 CTCAGAAGTTAAGCAGGGTCAGG - Intergenic
1032057778 7:128697481-128697503 CTCGGAAGCTAAGCAGGGTCGGG + Intergenic
1032225389 7:130027320-130027342 CTCGGAAGCTAAGCAGGGTCAGG + Intronic
1034335944 7:150323553-150323575 CCCCTCAGGTAAGCGGGGACTGG + Exonic
1036711517 8:11082487-11082509 CACCAGAGGCAAGCTGGGTCTGG - Intronic
1037559308 8:20058315-20058337 CACCTAAGCTAAGCTGGGTTTGG - Intergenic
1037587860 8:20290217-20290239 CTCGGAAGCTAAGCAGGGTCGGG + Intronic
1038039907 8:23715781-23715803 CTGCTAAGGTGAGGTCGGTCAGG + Intergenic
1038557157 8:28530454-28530476 CTCGGAAGCTAAGCAGGGTCGGG + Intronic
1038936351 8:32256539-32256561 CTCAGAAGCTAAGCAGGGTCGGG + Intronic
1041580611 8:59455928-59455950 CTCAGAAGCTAAGCAGGGTCGGG + Intergenic
1042768954 8:72357765-72357787 CTCAGAAGCTAAGCAGGGTCAGG + Intergenic
1044121057 8:88396486-88396508 CTCCCAAGCTAAGCAGAGTCAGG - Intergenic
1044436277 8:92167485-92167507 CTCGGAAGCTAAGCAGGGTCGGG - Intergenic
1048871559 8:138803413-138803435 CTCGGAAGCTAAGCAGGGTCGGG - Intronic
1053667227 9:40324795-40324817 CACCGCAGGTAAGCTGGGTTTGG + Intronic
1054157206 9:61649313-61649335 CTCCAAATGTAAGCTGGCTGTGG + Intergenic
1054378371 9:64464823-64464845 CACCGCAGGTAAGCTGGGTTTGG + Intergenic
1054476981 9:65580318-65580340 CTCCAAATGTAAGCTGGCTGTGG + Intergenic
1054517383 9:66051488-66051510 CACCGCAGGTAAGCTGGGTTTGG - Intergenic
1059184234 9:112252301-112252323 CTCAGAAGTTAAGCAGGGTCGGG + Intronic
1060545650 9:124457594-124457616 CTCCTCAGGAAAGGTGGGTGAGG + Exonic
1061433227 9:130544438-130544460 CTCCTGAGGAAGGCTGGGCCTGG + Intergenic
1061519848 9:131111656-131111678 CTTCAAAGGTAAGCTGGGGCGGG + Exonic
1188256393 X:27966367-27966389 CACCTAATGTAGGCTGGGTTTGG + Intergenic
1189009936 X:37036850-37036872 CACCTGAGGCAAGCTGGGCCAGG + Intergenic
1189038639 X:37518865-37518887 CACCTGAGGCAAGCTGGGCCAGG - Intronic
1189468079 X:41292841-41292863 CTCGGAAGCTAAGCAGGGTCGGG + Intergenic
1190813657 X:53909086-53909108 CTTGGAAGCTAAGCTGGGTCAGG + Intergenic
1192339657 X:70253085-70253107 TTCCGAAGCTAAGCAGGGTCGGG + Intergenic
1193009044 X:76655062-76655084 CTCAGAAGCTAAGCAGGGTCAGG - Intergenic
1194022571 X:88710887-88710909 CTCCTAAGGTAAACTTGCTTTGG + Intergenic
1195322008 X:103728118-103728140 CTCCTCAGGTGAGCTGAGTGGGG - Exonic
1196679641 X:118457820-118457842 GGCATAAGGTAAGCTGGGTCTGG + Intergenic
1201319136 Y:12677987-12678009 CTCCTTAGCTAAGCTAGGTTTGG + Intergenic
1201385564 Y:13436448-13436470 CTCCAAAGTCAAGCGGGGTCTGG + Intronic