ID: 923816204

View in Genome Browser
Species Human (GRCh38)
Location 1:237381700-237381722
Sequence GGATACTGTGGACAGCACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 228}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923816197_923816204 12 Left 923816197 1:237381665-237381687 CCTGTCCTCTGAGAACATGCCTT 0: 1
1: 0
2: 0
3: 14
4: 222
Right 923816204 1:237381700-237381722 GGATACTGTGGACAGCACCTGGG 0: 1
1: 0
2: 0
3: 17
4: 228
923816199_923816204 7 Left 923816199 1:237381670-237381692 CCTCTGAGAACATGCCTTGTGGA No data
Right 923816204 1:237381700-237381722 GGATACTGTGGACAGCACCTGGG 0: 1
1: 0
2: 0
3: 17
4: 228
923816201_923816204 -7 Left 923816201 1:237381684-237381706 CCTTGTGGACAGAAGAGGATACT No data
Right 923816204 1:237381700-237381722 GGATACTGTGGACAGCACCTGGG 0: 1
1: 0
2: 0
3: 17
4: 228
923816196_923816204 13 Left 923816196 1:237381664-237381686 CCCTGTCCTCTGAGAACATGCCT 0: 1
1: 0
2: 1
3: 20
4: 283
Right 923816204 1:237381700-237381722 GGATACTGTGGACAGCACCTGGG 0: 1
1: 0
2: 0
3: 17
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923816204 Original CRISPR GGATACTGTGGACAGCACCT GGG Intronic