ID: 923816233

View in Genome Browser
Species Human (GRCh38)
Location 1:237382161-237382183
Sequence CTGATCAGTAGAAAATCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923816233_923816235 -5 Left 923816233 1:237382161-237382183 CCAACTGATTTTCTACTGATCAG 0: 1
1: 0
2: 0
3: 7
4: 137
Right 923816235 1:237382179-237382201 ATCAGGTTACTTAATGAAACAGG 0: 1
1: 0
2: 1
3: 13
4: 127
923816233_923816236 8 Left 923816233 1:237382161-237382183 CCAACTGATTTTCTACTGATCAG 0: 1
1: 0
2: 0
3: 7
4: 137
Right 923816236 1:237382192-237382214 ATGAAACAGGCCAAGTTTTTCGG 0: 1
1: 0
2: 1
3: 12
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923816233 Original CRISPR CTGATCAGTAGAAAATCAGT TGG (reversed) Intronic
902094127 1:13928530-13928552 CAAATCAGGAGAAAATGAGTTGG + Intergenic
905175062 1:36130336-36130358 CAGATCAGTAGAAATTTAGAAGG - Intergenic
905322104 1:37125181-37125203 CTGGGCAGTAGAAAATCAGGTGG - Intergenic
909227995 1:73050105-73050127 TTGCTCTGTCGAAAATCAGTTGG - Intergenic
912598784 1:110906220-110906242 CTGGTAAGTAGAAATACAGTTGG - Intergenic
915960190 1:160259972-160259994 CTGACCAATTAAAAATCAGTTGG + Intronic
919174777 1:194005063-194005085 CTGATAAGTAGAAAATTTGATGG - Intergenic
920973868 1:210767263-210767285 CTGCTCACTGGAAAATGAGTGGG + Intronic
921468285 1:215518164-215518186 CTGATGAATAGAAATTAAGTTGG - Intergenic
922401522 1:225262627-225262649 CTGATTTGTCGAAGATCAGTTGG + Intronic
923315005 1:232771867-232771889 CAGATGAATAGGAAATCAGTAGG - Intergenic
923816233 1:237382161-237382183 CTGATCAGTAGAAAATCAGTTGG - Intronic
1063945738 10:11174648-11174670 CTGATCATTATAAAATATGTTGG + Intronic
1066307400 10:34159293-34159315 CTGTTGAGTAGCAAATGAGTTGG + Intronic
1066539011 10:36423969-36423991 CTGATAAGTAGTAAATCAGCGGG - Intergenic
1072182325 10:92998361-92998383 TTGATAAATTGAAAATCAGTGGG + Intronic
1079886987 11:26001948-26001970 ATGATCATTAGAAAATGACTAGG + Intergenic
1080079323 11:28195983-28196005 CTGCTTAGTTGAAGATCAGTTGG + Intronic
1081260359 11:40952377-40952399 ATGTTCAGTATAAAATTAGTAGG - Intronic
1081271642 11:41091909-41091931 TTGAGGAGTAGAAAATCAATGGG + Intronic
1087668450 11:101077746-101077768 CTGATGAGAAGGACATCAGTTGG + Intronic
1087792528 11:102421849-102421871 ATGATCTGTAGAACATCAATGGG + Intronic
1092378050 12:7971944-7971966 CTGCTGAGTAGAAAACCGGTGGG + Intergenic
1095093678 12:38131595-38131617 CTTAGGAGTAAAAAATCAGTAGG + Intergenic
1095238052 12:39822255-39822277 CTGTGAAGAAGAAAATCAGTTGG - Intronic
1097874106 12:64627593-64627615 CTGATCAGATGAAAACCAGGTGG - Intronic
1098041783 12:66360275-66360297 CTGATGAGAAGAAACCCAGTGGG - Intronic
1100826632 12:98480904-98480926 TTGATCAGTGGACAACCAGTAGG - Intergenic
1105771020 13:23611776-23611798 CTGATCAATACAAATGCAGTGGG + Intronic
1110963343 13:81658742-81658764 TTGATCAAGAGAAAATCACTGGG - Intergenic
1111514142 13:89305822-89305844 GTAATCAGTAGAAAAATAGTGGG + Intergenic
1112308815 13:98299938-98299960 CTAATCAGTAGCTAATCAGGGGG + Intronic
1116228354 14:42182241-42182263 TAGATCAGTAGAAAATATGTAGG + Intergenic
1118246398 14:64115110-64115132 CCAGTCAGTAGATAATCAGTTGG - Intronic
1122159257 14:99771085-99771107 CTGATCATTATAATATCAGTGGG - Intronic
1126306292 15:47261904-47261926 CTGATAAATAGAAAAACAATAGG - Intronic
1127009789 15:54611018-54611040 TTGATCTGTAGAAAATCACAGGG + Intronic
1130719131 15:86369524-86369546 CTGATAAACACAAAATCAGTTGG + Intronic
1133544686 16:6794408-6794430 CTGAGCAATAGAAAAGCAGCAGG - Intronic
1135012806 16:18897865-18897887 CCTCTCAGGAGAAAATCAGTAGG - Intronic
1135233793 16:20736552-20736574 CTGTGAAGTAGAAAATCAGAGGG - Intronic
1135319725 16:21485449-21485471 CCTCTCAGGAGAAAATCAGTAGG - Intergenic
1135372561 16:21916937-21916959 CCTCTCAGGAGAAAATCAGTAGG - Intergenic
1135439224 16:22453766-22453788 CCTCTCAGGAGAAAATCAGTAGG + Intergenic
1136329953 16:29567162-29567184 CCTCTCAGGAGAAAATCAGTAGG - Intergenic
1136444582 16:30306866-30306888 CCTCTCAGGAGAAAATCAGTAGG - Intergenic
1137054990 16:35740893-35740915 CTGATAGGTGGAAATTCAGTGGG + Intergenic
1140773234 16:78225642-78225664 CTCATCTGGAGAAAATCAGCTGG - Intronic
1150979244 17:70123026-70123048 CTGTCCATTGGAAAATCAGTTGG - Intronic
1151337053 17:73446207-73446229 CTGATCACTAGAAAATATATGGG + Intronic
1164387257 19:27783492-27783514 TTGAGTATTAGAAAATCAGTAGG - Intergenic
1166843190 19:45711488-45711510 CTGAAGAGTAGAAAATCAACAGG + Exonic
926909122 2:17833478-17833500 ATGATAAGTATAAAATAAGTTGG - Intergenic
927324463 2:21787823-21787845 CTGAACAGTAGATTGTCAGTGGG - Intergenic
934044189 2:88158378-88158400 CTGCTCTGTCGAAGATCAGTTGG + Intergenic
934767730 2:96889376-96889398 CTCATCAATAGAACATCAGTAGG + Intronic
935262646 2:101368646-101368668 CTGAACCCTAGAAAATGAGTAGG + Intronic
937965133 2:127500801-127500823 CTAATCAGTCGAAAATGAGCAGG - Intronic
939269571 2:139920447-139920469 CAGATGAGTTAAAAATCAGTTGG - Intergenic
945383979 2:209174844-209174866 CTGATCAGTAGATACTAATTGGG + Intergenic
945810081 2:214538337-214538359 TGTATGAGTAGAAAATCAGTGGG + Intronic
946629712 2:221653790-221653812 CTAATCAATAGGAATTCAGTTGG + Intergenic
948037482 2:234870498-234870520 CTGATCAGCAATACATCAGTAGG - Intergenic
1170152561 20:13240671-13240693 CTGATCAGTGGATAATGAGAGGG + Intronic
1184719664 22:46303749-46303771 CTGTTCACTTGAAATTCAGTTGG + Intronic
949828488 3:8187727-8187749 CTGACCAGGAGAAACTCAGTAGG + Intergenic
949854202 3:8445088-8445110 GAGAAAAGTAGAAAATCAGTGGG + Intergenic
952828069 3:37540418-37540440 GTGATCAGTAGAAAGTAAATTGG + Intronic
953519852 3:43631482-43631504 CTAATTTATAGAAAATCAGTTGG - Intronic
953873897 3:46653267-46653289 CTCCTCTGTAAAAAATCAGTTGG - Intergenic
954764469 3:52901492-52901514 GTTATCAGTAGGAAATCTGTTGG - Intergenic
955525662 3:59817276-59817298 AAGATCAGAAGAAAATCAATTGG + Intronic
960932200 3:122864419-122864441 CTGTTCAGTACAAAATGACTTGG - Intronic
963433371 3:145237394-145237416 CTGAGCAGAAGAAAGTGAGTTGG - Intergenic
963822029 3:149908043-149908065 CTGACAAGAAGAAAATGAGTTGG + Intronic
965512992 3:169589648-169589670 CTGTTCAGCAATAAATCAGTGGG - Intronic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
970595220 4:17594097-17594119 CGGCTGAGTAGAAAATAAGTGGG + Intronic
974564020 4:63560661-63560683 AAGATCAGAAAAAAATCAGTGGG + Intergenic
975134210 4:70858385-70858407 CTGATTAGTAAGAAATAAGTAGG + Intergenic
975175729 4:71286393-71286415 CTGATCAGTACAAAAGCATATGG - Intronic
977859875 4:101944118-101944140 CTGAGGAGTATTAAATCAGTTGG - Intronic
981055342 4:140354817-140354839 GTGACAATTAGAAAATCAGTTGG + Intronic
982558135 4:156895326-156895348 CAAATCAATAGAAAATGAGTGGG + Intronic
988190605 5:27928111-27928133 TTAATCAGTAGAAATTAAGTTGG - Intergenic
988589910 5:32539809-32539831 CTGTTCAGAAGTAAAGCAGTTGG + Intronic
989123802 5:38031628-38031650 CAGATCAGAAGAAACTCAATTGG - Intergenic
992123072 5:73614414-73614436 GAGATCTGTAGAAAAACAGTGGG + Intergenic
993187542 5:84638422-84638444 TTGCTCAGTAGAACATCACTGGG - Intergenic
994152924 5:96470111-96470133 CTGGGAAGTAGAAAATGAGTGGG - Intergenic
994707548 5:103224205-103224227 CTGCTCAGGAGAAACGCAGTAGG - Intergenic
994915126 5:105966023-105966045 ATTAACAATAGAAAATCAGTTGG - Intergenic
996602093 5:125276377-125276399 CTGAACTGTAAAAAATCACTGGG + Intergenic
997258340 5:132446124-132446146 CTGATCAGTACGAAAACAATAGG - Intronic
1003018805 6:2492126-2492148 CTGATCAGAAAAAAATCCCTTGG - Intergenic
1003270956 6:4607377-4607399 GGGATCATTAGAAAATCAGGAGG - Intergenic
1003515207 6:6812065-6812087 CTGATAAAGAGACAATCAGTTGG - Intergenic
1004773428 6:18813087-18813109 ATTACCAGTTGAAAATCAGTGGG - Intergenic
1005103868 6:22202365-22202387 CTGATCAGCATAAAATAATTAGG + Intergenic
1005806248 6:29476639-29476661 CTGATCAGCAGAAGATCACCTGG - Intergenic
1006190607 6:32205599-32205621 CTGATCAGTAGTAAACCTCTGGG - Intronic
1008197278 6:48539492-48539514 CAGTTCAGTAGAAAATTAGAGGG - Intergenic
1009503320 6:64444120-64444142 ATTATCAATAGAAAATCATTAGG + Intronic
1010315908 6:74450122-74450144 CTGCTCTGTCGAATATCAGTTGG + Intergenic
1010487912 6:76437796-76437818 CTGACCAAAAGAAAATCTGTTGG + Intergenic
1012671823 6:102060369-102060391 ATGATAAGAAGAAAATCAGAGGG + Intronic
1015460030 6:133479870-133479892 CTGAGTAGTAGCAAATCTGTAGG - Intronic
1015683826 6:135837161-135837183 CTCCACAGTAGAAAATCAGATGG - Intergenic
1018401261 6:163422857-163422879 CTGGTCAGTAGCAAATCATTGGG + Intronic
1019208725 6:170386193-170386215 CTGATCTGTAGAGAAGCAGAGGG + Intronic
1020828998 7:13069518-13069540 CTGATCGGTATAAATTCAGTAGG - Intergenic
1020863514 7:13524962-13524984 CTTTTCAGTACAGAATCAGTTGG - Intergenic
1021693460 7:23252697-23252719 ATAACAAGTAGAAAATCAGTAGG + Intronic
1023031039 7:36090699-36090721 CTGGTCAATAGAAAAATAGTGGG - Intergenic
1026243810 7:68600343-68600365 CTGAATTGTAGAGAATCAGTAGG + Intergenic
1026429565 7:70330937-70330959 CTGATGTGTAGAAAAACAGCTGG + Intronic
1027646497 7:80807594-80807616 CTAGTCAGTAGAAATACAGTTGG - Intronic
1030362891 7:108613746-108613768 AAGATCAGTAGAAAATAGGTTGG + Intergenic
1031301382 7:120065838-120065860 ATGAGCAGGAGAAAATCACTGGG + Intergenic
1033421949 7:141211468-141211490 CTTATAAATTGAAAATCAGTGGG + Intronic
1036099344 8:5760495-5760517 CTCATCATTAGCAAGTCAGTGGG - Intergenic
1036411759 8:8508198-8508220 CTAATCAGTAGAAAAGCTGCGGG - Intergenic
1038240716 8:25805878-25805900 CTGATAAGTAGAGCATAAGTTGG + Intergenic
1039653767 8:39375694-39375716 ATGATTTGTAGGAAATCAGTTGG + Intergenic
1043275786 8:78390664-78390686 CTGATCAGTAGGTCAACAGTGGG - Intergenic
1044408057 8:91853150-91853172 CTGTTCTGTAGAAAGTCATTGGG - Intergenic
1045229731 8:100292021-100292043 GTGATCAGTAGAAACTCTGCTGG - Intronic
1045873815 8:106955415-106955437 TTGACTTGTAGAAAATCAGTTGG - Intergenic
1046112947 8:109748787-109748809 CTGATCTGAGGAAAATCAGGAGG + Intergenic
1047945835 8:129878558-129878580 CTGATCAATAGAAAATTGTTAGG - Intronic
1048003455 8:130399034-130399056 CTGGCCAGTAGAATATAAGTAGG + Intronic
1048969345 8:139635869-139635891 CTGATAAGTAGAAAAAAAGCAGG - Intronic
1055268428 9:74526790-74526812 CTGATCAGAAGAAAAAAAGGGGG + Intronic
1059897622 9:118884862-118884884 CTGAACTGTAGAAAATTAATTGG + Intergenic
1186272768 X:7907322-7907344 CAGATCAGAAGAAAAGCTGTAGG - Intronic
1189691188 X:43618195-43618217 CTGAGCAGTTGGAAATCATTGGG - Intergenic
1191936181 X:66429500-66429522 CTGATGAGTAGAGAAACACTGGG + Intergenic
1192633567 X:72796021-72796043 CTCCTTTGTAGAAAATCAGTTGG + Intronic
1192648143 X:72924780-72924802 CTCCTTTGTAGAAAATCAGTTGG - Intronic
1196023381 X:111013700-111013722 CTGATAAGAAGAAATTCTGTTGG - Intronic
1196529930 X:116774267-116774289 TTGCTCTGTTGAAAATCAGTTGG - Intergenic
1199391939 X:147290462-147290484 CTAAACAGAGGAAAATCAGTGGG + Intergenic
1199521106 X:148736898-148736920 TTGCTCTGTAGAAGATCAGTTGG + Intronic
1201408929 Y:13678682-13678704 TTGCTTTGTAGAAAATCAGTTGG - Intergenic
1201449097 Y:14090719-14090741 CAGATCAGAAGAAAAGCTGTAGG + Intergenic