ID: 923821208

View in Genome Browser
Species Human (GRCh38)
Location 1:237444470-237444492
Sequence TAGATTTAGTTCAGTACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923821205_923821208 19 Left 923821205 1:237444428-237444450 CCTCTTTACATTGCTTTCTAGAT 0: 1
1: 0
2: 1
3: 31
4: 358
Right 923821208 1:237444470-237444492 TAGATTTAGTTCAGTACACCTGG 0: 1
1: 0
2: 0
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923821208 Original CRISPR TAGATTTAGTTCAGTACACC TGG Intronic
900711787 1:4119102-4119124 CAGTTTTAGGTCAGGACACCGGG - Intergenic
901889617 1:12251523-12251545 TAGTATTTGTACAGTACACCGGG + Intronic
903327827 1:22581404-22581426 CAGATGTGGTTCAGTTCACCTGG - Intronic
910780824 1:90930679-90930701 TACATTTAGGTGAGTACACAAGG + Intronic
911357711 1:96842717-96842739 CTGATTTAGTTAAGTACACATGG + Intergenic
913009966 1:114673144-114673166 TAAATTGAGTTCATAACACCAGG + Exonic
916551180 1:165851159-165851181 TAGAGTTGGTCCAGTGCACCTGG + Intronic
919361863 1:196606765-196606787 TATATTTAGTTCAGGACCTCAGG - Intronic
921563376 1:216685862-216685884 TAGACATAGATCAGTTCACCAGG + Intronic
923821208 1:237444470-237444492 TAGATTTAGTTCAGTACACCTGG + Intronic
923831220 1:237559553-237559575 TTTATTTAGTTCATTACACATGG + Intronic
924150122 1:241121342-241121364 AAGGTTTAGTGCAATACACCTGG + Intronic
924373730 1:243384538-243384560 TAGGTTTAGTAAAGTGCACCAGG + Intronic
1063761421 10:9082809-9082831 TAGATTTAGTTCTTATCACCTGG + Intergenic
1065540292 10:26758837-26758859 TAAATTTAGTTAAGTATACTTGG + Intronic
1066207137 10:33200402-33200424 TGCATTTGGTACAGTACACCTGG + Intronic
1068275084 10:54784196-54784218 TAGATTTGGTTGAGGACACACGG + Intronic
1068881294 10:62051994-62052016 AAGATTTACTTCATTACACTGGG - Intronic
1070427364 10:76302483-76302505 TAGATTTATTTCATTGCACATGG + Intronic
1071673668 10:87635499-87635521 AAGATTTAGTTCACTCCACCAGG - Intergenic
1078886622 11:15506816-15506838 TAGATTTAGTCCATATCACCAGG - Intergenic
1079176257 11:18144064-18144086 GATATTTAGCTCAGTACTCCTGG + Intronic
1088142613 11:106635508-106635530 TAGAATTAGGTCAGAACACCCGG + Intergenic
1088568714 11:111199995-111200017 TAGATTTATTACAGCAGACCAGG - Intergenic
1091501922 12:1026297-1026319 ATGATTCAGTTAAGTACACCTGG + Intronic
1093018053 12:14174420-14174442 TAGATTTAGTTGAGTAGATGAGG + Intergenic
1093642028 12:21538869-21538891 TAGAGTAAGTTCAGCACCCCAGG - Intronic
1098983768 12:76987554-76987576 TTGATTTAGTTCTGTGCATCAGG + Intergenic
1099019736 12:77388768-77388790 TTGATTTATTTCAGCACCCCAGG - Intergenic
1100610143 12:96185136-96185158 TGGATTTAGATCAGAAAACCTGG + Intergenic
1101465795 12:104947911-104947933 TAGACTTAGTTCATTAGCCCAGG - Intronic
1103377038 12:120465016-120465038 TCGATTTATTTCATTCCACCAGG + Intronic
1110279055 13:73671560-73671582 TAGATGTACTTCAGGGCACCAGG - Intergenic
1111818780 13:93188598-93188620 TAGATTCAGTTAAGTAGACTAGG - Intergenic
1112659376 13:101490134-101490156 TAGGTTTAGTTGAGTACATGAGG + Intronic
1115263650 14:31478156-31478178 TTGATTTGATTCAGTAAACCTGG - Intergenic
1117354487 14:54910831-54910853 TGGACTTAGTTCAATACACTTGG + Intergenic
1118006999 14:61572324-61572346 TACATTTGGTTCAGAACACTAGG - Intronic
1120695798 14:87643513-87643535 TAGCTTCAGCTCAGTGCACCTGG - Intergenic
1123875640 15:24621470-24621492 TAGGCTGAGTTCAGTACTCCTGG + Intergenic
1126376533 15:48002447-48002469 TATAATTATTTCTGTACACCTGG + Intergenic
1144437925 17:15258044-15258066 TAGATCCAGTTCAGTAAAACAGG - Intronic
1156886068 18:42137932-42137954 TAGCTTTAGTCCAGTACTGCAGG - Intergenic
1159020973 18:63142815-63142837 ATGATTTAGTTCAGTTCACCTGG + Intronic
1159498524 18:69238030-69238052 TACAATTAGTTCAGTAGAACTGG - Intergenic
1159951889 18:74490085-74490107 TAGGTTTAGATGAGTTCACCAGG - Intergenic
1160723997 19:609463-609485 TAGATAAAGTTCAGGGCACCCGG + Intronic
1162107970 19:8382275-8382297 TAGATTTTGTTCAGGGCACAGGG - Intronic
1164533398 19:29065147-29065169 TAGATTTAGTTAACTAATCCTGG + Intergenic
927831969 2:26359215-26359237 TAGGTCTAGTTTAATACACCAGG - Intronic
933201231 2:79451645-79451667 TGAATTTAGTTCAGTAGACAAGG + Intronic
939607433 2:144269760-144269782 TAGTTTTAGTCCAGTCCACATGG + Intronic
939842269 2:147203957-147203979 TACATCTAGTACAGTACACAGGG + Intergenic
940187705 2:151005119-151005141 TATTCTGAGTTCAGTACACCAGG - Intronic
942199136 2:173553386-173553408 TAGATTTTGTGCTGTAAACCAGG - Intergenic
942577254 2:177377187-177377209 TAGATAAATTTCAGTCCACCAGG - Intronic
944073679 2:195702327-195702349 TAGATTGAATTCAGGACACCAGG + Intronic
948279133 2:236733009-236733031 TAGATTTAGTTCATTTCTCTAGG + Intergenic
1176643878 21:9331287-9331309 TTGAGTAAGTACAGTACACCAGG + Intergenic
1182356784 22:29725799-29725821 TGGATGGAGTTCAGGACACCTGG + Intronic
958258759 3:91354836-91354858 AAGATTTGGTTCACTCCACCAGG - Intergenic
959749868 3:109821124-109821146 TACAGTTAGTTAAGAACACCAGG + Intergenic
963696797 3:148573644-148573666 TAGATTTTGTTCAGGACCCAGGG - Intergenic
967995446 3:195162861-195162883 TTGATGTAGTTCAATACACAGGG + Intronic
1202743010 3_GL000221v1_random:73779-73801 TTGAGTAAGTACAGTACACCAGG - Intergenic
968671178 4:1852472-1852494 GAGATTTAGTTCAGTCCCCATGG - Intronic
973944945 4:55946513-55946535 TTGTTTTAGTTTAGTACATCTGG - Intergenic
974621512 4:64361588-64361610 TAGGTTTAGCTCAGCACTCCTGG - Intronic
974625439 4:64421146-64421168 GAGATTTAGTTCTGGACATCAGG - Intergenic
977267476 4:94873025-94873047 TAGATATAGTACAGCACATCAGG - Intronic
978648526 4:110971722-110971744 TAGATGTAGATCAGCACTCCTGG + Intergenic
982361813 4:154526643-154526665 TAGACTTGGTTTAGTACACATGG - Intergenic
990999702 5:61770341-61770363 CATTTTTAGTTCAGTAAACCAGG + Intergenic
993235989 5:85310846-85310868 TATATTTATTTCAGAACAACAGG + Intergenic
993284804 5:85980009-85980031 TAGATTTAATTAAGTAAACCAGG + Intergenic
1005216596 6:23535532-23535554 TAGCTTTAGATCATTACACATGG + Intergenic
1006904315 6:37522816-37522838 TAGACTTAGTTCTGTAGTCCAGG + Intergenic
1008996497 6:57665738-57665760 AAGATTTGGTTCACTCCACCAGG + Intergenic
1011309958 6:85970829-85970851 TAGATTTAGCTTAGTTCACTGGG + Intergenic
1012106204 6:95162394-95162416 CAGTTTTAGTTCACTAAACCTGG - Intergenic
1016428637 6:143959866-143959888 TTGGCTTAGTTCAGAACACCTGG - Intronic
1021712595 7:23430524-23430546 TAGGTTTAGTTCGGCACAGCTGG - Intronic
1039136799 8:34333892-34333914 TATATTTAGTTCAGCAGAGCAGG - Intergenic
1040033427 8:42846054-42846076 TGGATTTTATTCAGTACAGCAGG - Intergenic
1044271219 8:90246418-90246440 AAGATTCAATTCAGTACAGCAGG - Intergenic
1044497564 8:92906141-92906163 TATATTTTGTTCAGTTTACCTGG + Intronic
1044774519 8:95674407-95674429 TAGAGATACTTCAGTACCCCAGG + Intergenic
1046546978 8:115666136-115666158 TAGATTCAGTTCAATATACAGGG - Intronic
1047480660 8:125279187-125279209 TAGATGTGGTTCCGTGCACCTGG + Intronic
1051629083 9:19126459-19126481 GAGACTTATTTCAGAACACCGGG + Intronic
1056201675 9:84283024-84283046 TTCATTTAGTTCAGTTCAGCTGG + Intronic
1056292669 9:85159369-85159391 TAGATTTAGATCATTGCAACTGG + Intergenic
1056313979 9:85371034-85371056 AAGGTTTAGTTCACTCCACCAGG - Intergenic
1057110756 9:92468722-92468744 GTGATTTACATCAGTACACCTGG + Intronic
1203711644 Un_KI270742v1:103705-103727 TTGAGTAAGTACAGTACACCAGG - Intergenic
1187709711 X:22040944-22040966 TAGGTTTATTTCTGTACGCCAGG + Intronic
1188268612 X:28110562-28110584 TACAAGTAGTTCAGTATACCTGG + Intergenic
1188645858 X:32566288-32566310 TAGCTTTTCTTCAGTACTCCTGG - Intronic
1194774480 X:97945073-97945095 AAGGTTCAGTTCAGTACTCCTGG - Intergenic
1194792280 X:98165226-98165248 TTGATTGAGTTCAGAATACCTGG + Intergenic
1196219895 X:113100989-113101011 TAGAAATAGTTCAGTAGACTAGG + Intergenic