ID: 923828806

View in Genome Browser
Species Human (GRCh38)
Location 1:237530422-237530444
Sequence TCCAGGACTTTGTTGGCATT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923828806 Original CRISPR TCCAGGACTTTGTTGGCATT AGG Exonic
902120237 1:14159053-14159075 TCCAGTGCTTTGTTGGCTTCAGG - Intergenic
903415328 1:23178304-23178326 TCCAGGTGTTTTTTGTCATTGGG + Intergenic
905864238 1:41368035-41368057 TCCAGCCCTTTGGTGTCATTTGG + Intronic
906451961 1:45957912-45957934 GCCAGGACTTTGGTGTCCTTGGG + Intronic
907678924 1:56545515-56545537 TCCAGGAACTTCTTGGGATTGGG + Intronic
907830558 1:58060648-58060670 GCCAGGACTTTGTGGGCCCTTGG - Intronic
908547504 1:65176284-65176306 TCCAGAAATGTGTTGGCAGTGGG - Intronic
909538372 1:76764043-76764065 TCCAGGAGTTTCTTGGCCTGTGG + Intergenic
910385397 1:86677287-86677309 TCCAGGACTTTTTTTTAATTTGG - Intergenic
910666955 1:89735685-89735707 TCCAGGATTTTGATGCCAATTGG + Intronic
910881916 1:91929488-91929510 TCCTGGTCTTTCTTGGCTTTTGG - Intergenic
912848272 1:113097324-113097346 TAGAGGACTTTGTGGTCATTAGG + Intronic
915081967 1:153358756-153358778 TCCAGGCACTTATTGGCATTTGG - Intronic
917954560 1:180080726-180080748 TCAAGGAGTTTGTTGACCTTAGG + Intronic
918565048 1:185919224-185919246 TCCAAGACCTTGGTGTCATTTGG + Intronic
920174383 1:204090988-204091010 GCTAGGACTTTGTTGACAATGGG + Intronic
920640736 1:207749517-207749539 CTCAGAACTTTGTGGGCATTTGG + Intergenic
920762891 1:208802841-208802863 TGCCTGACTTTGTTGGCATTGGG + Intergenic
922289984 1:224202026-224202048 TCATGGACTTTGTAGACATTGGG - Intergenic
923828806 1:237530422-237530444 TCCAGGACTTTGTTGGCATTAGG + Exonic
924723211 1:246643140-246643162 TCCAGGACTTTGTGGGGCTGAGG - Intronic
924822527 1:247507089-247507111 AACAGGACAGTGTTGGCATTGGG - Exonic
1065457179 10:25919030-25919052 TCCAGGACTGTCCTGGAATTGGG + Intergenic
1066145194 10:32550519-32550541 TTCAGTATTATGTTGGCATTGGG + Intronic
1066445771 10:35481361-35481383 TCCAGGACATTCTTGGACTTAGG + Intronic
1066935886 10:41834559-41834581 TTCAGGACTTCGTTGGAAATGGG - Intergenic
1067213425 10:44280905-44280927 TCAAGGAGTCTGCTGGCATTTGG - Intergenic
1067801349 10:49361416-49361438 GCCAGGGCTTTGTTGTCATTGGG + Intergenic
1070410377 10:76134016-76134038 TCCTGGACTTTGTTGGGGGTGGG - Intronic
1070464368 10:76704542-76704564 TCCAGGTATTTGTAGGGATTTGG - Intergenic
1071079794 10:81797450-81797472 TCCAGACCTTTTTTAGCATTTGG + Intergenic
1071595936 10:86924899-86924921 TCCAGGACTTTGTTAACTTCAGG + Exonic
1071696026 10:87872530-87872552 TGCAGGACTTTTTTGGCACTTGG + Intronic
1073303495 10:102485202-102485224 ACAAGGACTGTGGTGGCATTCGG + Intronic
1077254056 11:1572696-1572718 TCCTGGCCTTTGTTGGCGCTGGG + Intergenic
1077712557 11:4551579-4551601 TCCCGCTCTTTGTAGGCATTAGG - Intergenic
1080183225 11:29448199-29448221 TCAATGATTTTGTTGGAATTAGG - Intergenic
1083050403 11:59771430-59771452 TCCAGGAGTTTGTAGTCAGTGGG + Intronic
1084020255 11:66413127-66413149 CCCAGGCCTCTGTTGGCACTTGG - Intergenic
1085606232 11:77901903-77901925 TTGAGGACTTTGTGGGGATTGGG - Intronic
1086118656 11:83283148-83283170 TCCAGAATTGTGTAGGCATTGGG - Intronic
1086426267 11:86686339-86686361 TCAAGGACTTAGTTGGCTTTAGG + Intergenic
1087104288 11:94394798-94394820 TCAAGGACTCTGCTGGCCTTGGG + Intronic
1087394638 11:97582040-97582062 TTCAGGATTCTGTTTGCATTTGG - Intergenic
1088616391 11:111633765-111633787 TCCAGGACTTTTATGGCATTTGG + Intronic
1088774741 11:113071266-113071288 TCCTGGATTTTGTTGCCACTGGG - Intronic
1089834804 11:121360647-121360669 TCCAGGACTTTGTTAACTTCAGG - Intergenic
1093135058 12:15439893-15439915 TCAAGGTGTTTGTTGCCATTGGG + Intronic
1094502617 12:31034584-31034606 TCCAGAAATTTGTTGGCATGTGG + Intergenic
1095566726 12:43633211-43633233 TCAAGGCATTTGTTGTCATTGGG + Intergenic
1096126159 12:49121328-49121350 GCCAGGAGTTTGATGGGATTGGG + Intergenic
1096934429 12:55255883-55255905 GCCAGGACTTTGTTGGAGTAAGG + Intergenic
1097466357 12:59929282-59929304 ACCAGTACTGTGCTGGCATTGGG + Intergenic
1097599641 12:61675034-61675056 TCCATGACTTTGCTGGGACTAGG - Intergenic
1099273391 12:80543541-80543563 TCCAGGACTTCATTTGCCTTTGG - Intronic
1099484977 12:83218114-83218136 TTCATGAGTTTGTTGGCATTGGG - Intergenic
1099523412 12:83690828-83690850 TCCAGGGCTGTGCTGGCTTTGGG + Intergenic
1099837792 12:87929585-87929607 ACTAGGACTGTGTTGTCATTTGG + Intergenic
1099883443 12:88497930-88497952 CCCAGAACTTTGTTGGGATGCGG - Intronic
1100576754 12:95899038-95899060 TCCAGTACTTTCTGGGAATTGGG + Intronic
1102709007 12:114908911-114908933 TGCAGGGCCTGGTTGGCATTTGG - Intergenic
1103166111 12:118772133-118772155 TCCAGGCATTTGTTGGCTTTTGG - Intergenic
1105387801 13:19948103-19948125 TCCACATCTTTGTTAGCATTTGG - Intergenic
1106305233 13:28503866-28503888 TCCAGGTCTCTGATGGGATTGGG + Intergenic
1109578244 13:64290463-64290485 TCCATGTCTTTGTTAGCTTTTGG - Intergenic
1113371232 13:109727445-109727467 ACCAGGACTGTGTTTGCCTTCGG + Intergenic
1114001746 14:18259906-18259928 TTGAGGCCTTTGTTGGAATTGGG - Intergenic
1116908563 14:50432309-50432331 TCCAGCACTTTGTCCTCATTAGG - Intronic
1121155239 14:91677102-91677124 TCCAGGATTTTTATGGCTTTGGG - Intronic
1121601812 14:95210843-95210865 TGCAGGACTTTGCGGGCAGTTGG - Exonic
1122295219 14:100701721-100701743 TCCATGCCTTTGGTGGCCTTTGG + Intergenic
1126166524 15:45658649-45658671 TCGAGGACTTTGTTTGAATCAGG - Intronic
1126303484 15:47226494-47226516 TCCAGTACTTTGTTATCAATAGG + Intronic
1127140485 15:55970463-55970485 TCCAGTACTGTGTTGGCTTCAGG + Intronic
1134048961 16:11123586-11123608 TCCATGACTCTGTTGGACTTGGG + Intronic
1139110556 16:63885716-63885738 TACAAGACTTTGTTTGGATTTGG + Intergenic
1140286235 16:73605553-73605575 TACAGGACTCTGTAGGAATTTGG - Intergenic
1140756699 16:78074142-78074164 TCCAAGACTTTCTGGGAATTTGG + Intergenic
1144210292 17:13008717-13008739 TCCAGGAGTCTCTTGGCATGAGG - Intronic
1148069015 17:44895838-44895860 TCCAGGATCATGTTTGCATTTGG + Intronic
1148771402 17:50069234-50069256 TTCATAACTTTGTTGGCCTTGGG - Intronic
1148867678 17:50637373-50637395 TCCAGGCCTTTTTTGTAATTAGG - Intronic
1149062057 17:52434231-52434253 TCTTGGACTCTGTTGGCACTGGG - Intergenic
1149362638 17:55911135-55911157 TCCAGGTCTTTGTTGGGCCTGGG + Intergenic
1151527724 17:74682437-74682459 TCTAGGACTTTGTTTGGAATTGG - Intronic
1153310381 18:3671937-3671959 TGCAGGACTCTGTTGGCAATTGG - Intronic
1156321356 18:36027142-36027164 TCCAGAACTTTTTTGGGAGTTGG - Intronic
1156430517 18:37068464-37068486 TCCACATCCTTGTTGGCATTTGG + Intronic
1158539960 18:58344329-58344351 TCAAGGGCATTCTTGGCATTTGG + Intronic
1159346272 18:67210136-67210158 TCCAGCACTTTGTTTTCAGTGGG + Intergenic
1159435027 18:68405568-68405590 TGTTGGACTTTGTAGGCATTAGG - Intergenic
1159645025 18:70907766-70907788 TCCTGGACTTAGATAGCATTGGG + Intergenic
1160068648 18:75604507-75604529 TCTAGGGCTTTTTTGGCTTTAGG - Intergenic
1161851923 19:6741733-6741755 TCCAGGGCTTTTTTGGATTTTGG - Intronic
1163329288 19:16626866-16626888 TCCAAGAGTTTCTTGGCAGTAGG - Intronic
1164481181 19:28612092-28612114 TCCAGAACTTTGTGGTCAGTAGG - Intergenic
928592143 2:32828005-32828027 ACCATGACACTGTTGGCATTTGG + Intergenic
930050436 2:47211539-47211561 TCCAGGATTCTGATGGCATCAGG + Intergenic
931024051 2:58088024-58088046 TCCATGACTTTCTTGCCATATGG - Intronic
933067120 2:77811385-77811407 TCTAGGGCTTTTTTGGTATTAGG - Intergenic
934536355 2:95137509-95137531 TCCAGGACTATGTTGACAGATGG - Intronic
935419186 2:102849022-102849044 TCCAAGACTTTCCTGACATTTGG - Intergenic
937779061 2:125816382-125816404 TCCAGGAGTCTTTTGGCATGGGG + Intergenic
940902217 2:159136135-159136157 TCCAAGGCTTTGTTTGCATCTGG + Intronic
941170732 2:162132575-162132597 TCCTGGAGTGTGTTGGCACTGGG + Intergenic
941233506 2:162940813-162940835 TCAAGGAATTTGTTGGAAGTAGG + Intergenic
941279548 2:163533125-163533147 GCCAGTACTTTGATGGCATTTGG - Intergenic
941347792 2:164391470-164391492 TCCATTACATGGTTGGCATTTGG - Intergenic
942860170 2:180599697-180599719 TCCAGTATTTTGTTAGAATTTGG - Intergenic
943110804 2:183603000-183603022 TCCAGGCATTTGTTGCCACTGGG + Intergenic
944644303 2:201763082-201763104 TCCAGGTGTTTGTTGCCACTGGG + Intronic
946750282 2:222887749-222887771 TCCAGGAAAAAGTTGGCATTCGG + Intronic
947497940 2:230652352-230652374 TCCTGGGCTTTTTTGGCATGGGG + Intergenic
949025305 2:241765041-241765063 GCCAGGACTTTGTCTGCAGTGGG + Intronic
1169970510 20:11265036-11265058 TTCAGGACTATTTTGACATTGGG + Intergenic
1174520495 20:51126415-51126437 TCCAGGACGTTGCTTGTATTTGG - Intergenic
1174828476 20:53791095-53791117 CCCAGGATTTTGTTGGCAGGAGG - Intergenic
1178360306 21:31943899-31943921 TCCAGGACTCTGATGAAATTGGG + Intronic
1178903396 21:36615704-36615726 TCCAGGACTTAGATGGGGTTGGG - Intergenic
1180426253 22:15190701-15190723 TTGAGGCCTTTGTTGGAATTGGG - Intergenic
1181105867 22:20574915-20574937 TCCAGGTCTGTCTGGGCATTGGG - Intronic
1182566683 22:31205442-31205464 GTCAGGACTTTGGTGGGATTTGG + Exonic
1185092206 22:48782001-48782023 TGCAGGCCTTTCTTGGCATGTGG - Intronic
949408736 3:3741406-3741428 CCCAGGACCTAGCTGGCATTTGG + Intronic
953191010 3:40688187-40688209 TCCAGGACTATCCTGGCTTTAGG + Intergenic
954017646 3:47708572-47708594 TCCAAGGCTTTTTTGTCATTAGG - Intronic
954050444 3:47971194-47971216 TCCAGGAATTTGGTGGAGTTCGG + Intronic
954432787 3:50480204-50480226 TCCAGGACATTGTAGCCTTTGGG + Intronic
954509719 3:51112887-51112909 TCAAGGACTCTGTTGGATTTTGG + Intronic
954961170 3:54566254-54566276 TCCAGGACATGGTGGGCAGTGGG - Intronic
956587329 3:70878518-70878540 TCCAAGAATTTATTGGCCTTGGG + Intergenic
956732247 3:72207315-72207337 ACCTGTACGTTGTTGGCATTTGG + Intergenic
959653755 3:108777984-108778006 TCCCTCACATTGTTGGCATTTGG + Intergenic
960849137 3:122034354-122034376 TCCAGGATTTTCTTGTCATATGG - Intergenic
962101007 3:132342592-132342614 GCCAGGACCTTTTTGGAATTTGG + Exonic
962602364 3:137002881-137002903 TCTAGGACTTTTATGGCTTTAGG + Intronic
962974917 3:140437543-140437565 TGGAGTGCTTTGTTGGCATTTGG - Intronic
964948511 3:162257121-162257143 TCCAGGACTTTTATGGTTTTAGG + Intergenic
967932763 3:194702493-194702515 CCCAGCACTTTGTTTGCATACGG - Intergenic
968970115 4:3789359-3789381 TCCAGGCGTTTCTTGGCTTTTGG - Intergenic
969286524 4:6205790-6205812 TCCAGGACTTCCTTGGCTTGCGG + Intergenic
972423970 4:38915441-38915463 TCAAGTGCTTTGTTTGCATTGGG - Intronic
973074061 4:45900804-45900826 TCCAGGACTTTGTTCCTATGTGG + Intergenic
974772518 4:66434250-66434272 TCCAGGCCTTTGATGGGAGTGGG + Intergenic
975032695 4:69641506-69641528 TCCAGGCTTTTTTTGGCCTTGGG - Intronic
976112368 4:81689704-81689726 TCCTGAAATTTGTAGGCATTAGG - Intronic
976237707 4:82916952-82916974 ACCTGGACTGGGTTGGCATTTGG - Exonic
977426002 4:96867888-96867910 TCCAGGGCTTTTATGGCCTTAGG - Intergenic
978069877 4:104454051-104454073 TCCAGTTCTTTTTTGGCATCTGG + Intergenic
978386033 4:108176068-108176090 TCCTGGGCTCTGTTGGCATTGGG + Intergenic
979441616 4:120756983-120757005 TGCTGGACTCTGTTGGTATTTGG - Intronic
979558478 4:122076956-122076978 GTCAGGACTTTGGTGGGATTTGG - Intergenic
982248827 4:153383549-153383571 TCCAGGCCTTGGTTGGGATAAGG + Intronic
982352032 4:154426177-154426199 TCAAGGACTTTGGTGGCAATAGG - Intronic
988706222 5:33728372-33728394 TCCAGGACACTGTTGGCTGTGGG + Intronic
990830006 5:59945727-59945749 ACCATCACTTTGTTGGCATTAGG - Intronic
994199686 5:96958696-96958718 TCCTGCACTTTTTTGGCTTTTGG + Intronic
994596858 5:101849491-101849513 TCCAGTACTATGTTGACAGTGGG + Intergenic
995888432 5:116922058-116922080 TCCAGGCCTTTCTTGGCTTGTGG - Intergenic
997423476 5:133787303-133787325 TCCAGGACTGTGCTAGGATTGGG + Intergenic
998188095 5:139998370-139998392 TCCAGGACTTTCTTGGCCTTGGG - Intronic
999431093 5:151525934-151525956 TGCAGGACTTTGCTGCCAATGGG + Exonic
1003163855 6:3659436-3659458 TCCAGGACTATGTTGGGATCAGG + Intergenic
1006008078 6:31019077-31019099 TCCAGGAGACTGTTGGCAGTTGG - Intronic
1007720928 6:43885064-43885086 TCCATGTCTTTGTTGGCCATTGG + Intergenic
1007945532 6:45823509-45823531 TCCAGGAGTTTAGTAGCATTAGG - Intergenic
1013010942 6:106119395-106119417 TCCAGTAACTTGTTGGCTTTAGG + Intergenic
1014795570 6:125720328-125720350 TCCAGGACTTTGTTTACACTGGG - Intergenic
1015949945 6:138542208-138542230 TCCAGGCATTTCTTGGCTTTCGG - Intronic
1016827380 6:148400851-148400873 TCCAGCAGTATGTTTGCATTTGG + Intronic
1018655239 6:166027739-166027761 GCCAGGACTTTATTTGCATGAGG - Intergenic
1020258004 7:6513045-6513067 TGCAGGGGTTTGTGGGCATTCGG + Intronic
1021939193 7:25663015-25663037 TCCAGGACTCTGTCTGCTTTTGG - Intergenic
1023323213 7:39023567-39023589 ACCATGACTCTGTTGACATTTGG - Intronic
1025846383 7:65202133-65202155 TTGAGGACTTTGTGGGGATTGGG + Intergenic
1025896629 7:65708040-65708062 TTGAGGACTTTGTGGGGATTGGG + Intergenic
1026347417 7:69486124-69486146 TCCTGGACTTTTTAGGCTTTTGG - Intergenic
1029049282 7:97667381-97667403 TCCAGGACTTTGTATGCAGAGGG - Intergenic
1029536661 7:101161270-101161292 TTCTGGACTTTGCTGGCCTTGGG + Exonic
1032788788 7:135225738-135225760 TTCAGGATTATTTTGGCATTTGG - Intergenic
1033826267 7:145193758-145193780 TCAAGGTGTTTGTTGGCATTGGG - Intergenic
1034023824 7:147675147-147675169 TCCAGGCTTTTATTGGCTTTTGG + Intronic
1036684381 8:10899498-10899520 TCCTGGATCTTGTTGGCCTTGGG - Intronic
1038062527 8:23928822-23928844 TTCAGGACTCAGTGGGCATTAGG - Intergenic
1038342247 8:26696340-26696362 TCCAGGAAAGTGTTGGCATCTGG + Intergenic
1041949097 8:63479991-63480013 TCCAGGATTTGTTTGGAATTTGG + Intergenic
1043729914 8:83664134-83664156 TCCCAGACTTTTTTGCCATTAGG - Intergenic
1046571314 8:115969691-115969713 ACCAGGACTCTGTTGACATCAGG - Intergenic
1046616833 8:116486893-116486915 TGCAAGACTTTGTTGATATTGGG - Intergenic
1046841138 8:118858520-118858542 TGCAGGGCTTTGTGGGCAATTGG - Intergenic
1051039062 9:12784638-12784660 TCAAGTACTGTGTTGGCTTTAGG - Intronic
1051218553 9:14824920-14824942 TCCTGGAGTTTCTCGGCATTTGG - Exonic
1052138426 9:24945175-24945197 TCAAAGACCTTGTTGGGATTGGG - Intergenic
1057083064 9:92187277-92187299 TCAAGGACTTTCCTGGCACTAGG - Intergenic
1057905865 9:98982942-98982964 TCCACCACTTTTTAGGCATTTGG + Intronic
1189238740 X:39509120-39509142 TCCAGGACTCTGCTGGCTTCTGG - Intergenic
1189769962 X:44416140-44416162 TCCAGCACTGTGCTGGCATCAGG - Intergenic
1190445071 X:50515665-50515687 TCCCGGACTTTGCTGGTAATTGG - Intergenic
1191051841 X:56201984-56202006 TTCAGGACTCTCTTGGGATTCGG + Intergenic
1191870643 X:65742221-65742243 TCCTGGACTTGCCTGGCATTGGG + Intergenic
1192670900 X:73140138-73140160 TCCAGGAATGTGCTGGCAGTAGG - Intergenic
1196697026 X:118624351-118624373 CACAGAACTTTGTTGGCCTTTGG - Intronic
1197318003 X:124992220-124992242 TCCAGGACAGTCTTGGCAGTGGG - Intergenic
1198664488 X:139005118-139005140 TCCAGGGCTGTGCTGGCTTTAGG + Intronic
1199493989 X:148432767-148432789 TCCTGGCCTTTGTTGGCAGGAGG - Intergenic
1199612907 X:149632681-149632703 TCAAGGATTTTGTTTGCTTTTGG + Intergenic
1199853878 X:151744193-151744215 TCTAGGACTTTCTTGGCATCAGG - Exonic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200687398 Y:6268586-6268608 TCCAGGACATTAACGGCATTGGG + Intergenic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic
1201011348 Y:9550102-9550124 TCCAGGACATTCATGGCATTGGG + Intergenic
1201047875 Y:9906124-9906146 TCCAGGACATTAACGGCATTGGG - Intergenic