ID: 923832662

View in Genome Browser
Species Human (GRCh38)
Location 1:237575104-237575126
Sequence TTGCCAGCAGGGCAGTCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 196}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923832655_923832662 20 Left 923832655 1:237575061-237575083 CCCATGACACCAGTCTGTTTAGA 0: 1
1: 0
2: 0
3: 10
4: 119
Right 923832662 1:237575104-237575126 TTGCCAGCAGGGCAGTCCCAAGG 0: 1
1: 0
2: 2
3: 20
4: 196
923832654_923832662 23 Left 923832654 1:237575058-237575080 CCACCCATGACACCAGTCTGTTT 0: 1
1: 0
2: 2
3: 11
4: 160
Right 923832662 1:237575104-237575126 TTGCCAGCAGGGCAGTCCCAAGG 0: 1
1: 0
2: 2
3: 20
4: 196
923832657_923832662 11 Left 923832657 1:237575070-237575092 CCAGTCTGTTTAGAGAGAGAACA 0: 1
1: 0
2: 1
3: 18
4: 190
Right 923832662 1:237575104-237575126 TTGCCAGCAGGGCAGTCCCAAGG 0: 1
1: 0
2: 2
3: 20
4: 196
923832656_923832662 19 Left 923832656 1:237575062-237575084 CCATGACACCAGTCTGTTTAGAG 0: 1
1: 0
2: 0
3: 8
4: 117
Right 923832662 1:237575104-237575126 TTGCCAGCAGGGCAGTCCCAAGG 0: 1
1: 0
2: 2
3: 20
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923832662 Original CRISPR TTGCCAGCAGGGCAGTCCCA AGG Intronic
900823572 1:4908797-4908819 TTGCCAGCAGGAGACACCCAGGG - Intergenic
901871977 1:12143479-12143501 TTGCAAGCAGGGCAGACCTAAGG - Exonic
902870036 1:19308360-19308382 GAGGCACCAGGGCAGTCCCAGGG - Intronic
903129463 1:21269117-21269139 CTGCCAGCAGTGCCGACCCAGGG + Intronic
903192977 1:21667220-21667242 TTGACAGCAGGGCAGGGGCAGGG + Intronic
903522202 1:23959486-23959508 TTTCCCCCAGGGCAGTCCCAAGG + Intronic
905579945 1:39076702-39076724 TCCCCAGCAGCTCAGTCCCAGGG + Intergenic
906069724 1:43007875-43007897 TTGCAAGCAGGGGGGTCGCAGGG - Intergenic
910345371 1:86230280-86230302 TTGTCATCAGGGCTGTCCAATGG - Intergenic
911129242 1:94372460-94372482 GGGCCAGCAGGTCAGTCCAAGGG + Intergenic
912132492 1:106619783-106619805 TTGCCTACAGGCCAGTGCCAAGG - Intergenic
915674051 1:157514585-157514607 ATGCATGCAGTGCAGTCCCAGGG + Exonic
916025472 1:160829911-160829933 TGGCCAGCAGCACAGTCTCAGGG + Intergenic
917666406 1:177229927-177229949 GTGCCAGCAGGGCTGTCCATGGG - Exonic
920196105 1:204228349-204228371 TTCCCAGCAAGGCTGTCCCTAGG + Intronic
921798195 1:219372166-219372188 TTGCCAGGAGGGTAGTCCTTTGG - Intergenic
923832662 1:237575104-237575126 TTGCCAGCAGGGCAGTCCCAAGG + Intronic
924327453 1:242910122-242910144 TTCCCAGCAGGGCTCTCCCATGG - Intergenic
924955835 1:248925810-248925832 TTGCCAGCGGGGGAGTTCCAAGG + Intergenic
1063178122 10:3570595-3570617 TGGGCAGCAGGCCTGTCCCAGGG + Intergenic
1065968351 10:30786350-30786372 CTACCCACAGGGCAGTCCCATGG - Intergenic
1067018039 10:42772103-42772125 TGGCCAGGACGGCAGTCCCATGG + Intergenic
1067080783 10:43211191-43211213 TGGACACAAGGGCAGTCCCAGGG + Intronic
1067714109 10:48673200-48673222 CACCCAGCAGGTCAGTCCCAAGG - Intergenic
1067716118 10:48692222-48692244 CTGACAGCAGGGCAGTGCCCTGG - Intronic
1069824303 10:71245884-71245906 TTGGTCTCAGGGCAGTCCCAAGG + Intronic
1072286769 10:93923591-93923613 TTTCCTGCAGGGCAGCCCCCGGG - Intronic
1072920965 10:99577025-99577047 GAGCCAGCTGGGCACTCCCATGG + Intergenic
1073263353 10:102207413-102207435 GTGACAGCAGGGTAGTCCCCTGG + Intergenic
1074392682 10:113071312-113071334 TTGCCAACACAGCAGTCACAAGG - Intronic
1075158901 10:120005367-120005389 TTACCAGCTGGGCATTCACATGG - Intergenic
1075280348 10:121133497-121133519 CTGCCAGAAGGGCAGGCACATGG - Intergenic
1075528088 10:123202779-123202801 TGGGAAGCTGGGCAGTCCCAGGG + Intergenic
1076075929 10:127533785-127533807 TTGCCCGCAGGTCAGTCCTCAGG - Intergenic
1076584407 10:131535299-131535321 CTGCCATCAGGGCAGACCCTGGG - Intergenic
1076917293 10:133430629-133430651 TTGCCTGCAGGGAAGCCGCAAGG + Intergenic
1076937390 10:133575388-133575410 TTGCCTGCAGGGAAGCCGCAAGG + Intergenic
1077251349 11:1562071-1562093 TTGCCAGGAGGGCACTCCCAGGG - Intronic
1078422527 11:11224195-11224217 TGGTCAGCAGGACAGGCCCATGG - Intergenic
1078844692 11:15110614-15110636 AGCCCAGCATGGCAGTCCCATGG - Intergenic
1079604122 11:22343771-22343793 TTGCCAGGAGGTCAGACCCTCGG - Intronic
1081290013 11:41313138-41313160 TTGGCAGTAGGCCAGTTCCAGGG + Intronic
1081638208 11:44734884-44734906 CCCCCAGCAGGGCAGGCCCAGGG + Intronic
1083324000 11:61864137-61864159 GGGGCAGCAGGGCAGTCCCTCGG - Intronic
1083552199 11:63598350-63598372 TTGACAGAAGGGCAGGCCCATGG - Intronic
1084013626 11:66366255-66366277 GAGCAGGCAGGGCAGTCCCAGGG + Intronic
1084934386 11:72579205-72579227 TTGCCAGGGGAGCATTCCCAGGG - Intronic
1086853896 11:91843651-91843673 ATGAAAGCAAGGCAGTCCCAGGG - Intergenic
1089770242 11:120797256-120797278 TTCTCTGCAGGGCAGTCCCCAGG + Intronic
1090284658 11:125489328-125489350 TTGCCAGCGGAGCAGTGCCCTGG - Intronic
1090839749 11:130477569-130477591 TTTCCAGCAGGGCAAGGCCATGG + Intergenic
1090959572 11:131544089-131544111 ATGCATGCAGGTCAGTCCCATGG + Intronic
1092034225 12:5317025-5317047 TTCCCAGCTGGGCACTCCCCAGG + Intergenic
1095305105 12:40629235-40629257 TTGAGAGCATGGCAGTACCATGG + Intergenic
1099071375 12:78049095-78049117 TTGCCAGCACAGCAGTCTGAAGG - Intronic
1099593958 12:84633533-84633555 TTGACAGCAAGGGAGTCACAAGG - Intergenic
1100221330 12:92507250-92507272 TTCCCAGCAGGGATTTCCCAAGG + Intergenic
1109030742 13:57184466-57184488 TAACCAGCAGGGCAGTCCTTCGG + Intergenic
1109115133 13:58372696-58372718 TTTCCAACAGTGCAGTCTCAAGG + Intergenic
1110347504 13:74465376-74465398 ATGGCAGCTGGGCAGCCCCAGGG - Intergenic
1111228815 13:85313551-85313573 TTGTCAGCTGGGCACTTCCAGGG - Intergenic
1112167627 13:96936507-96936529 TTAACACCAGGACAGTCCCAGGG - Intergenic
1112667845 13:101597470-101597492 TTGCATGGAGGGCAGTCACAGGG - Intronic
1113385834 13:109846954-109846976 AGGCCAGCAGGGCTGTTCCAGGG + Intergenic
1118491767 14:66268077-66268099 TTGCAAGCAGTGAAGTCCAAAGG - Intergenic
1119777894 14:77259591-77259613 AAGCCAGCAGGGCAGCCCCGAGG + Intergenic
1121536679 14:94695711-94695733 TGGCCAGGAAGGCAGCCCCAGGG + Intergenic
1122407479 14:101508986-101509008 CTGCCAGCAGGGGGGTCTCAAGG + Intergenic
1122781572 14:104146013-104146035 GGGCCAGCAGGGCAGTGGCAAGG + Intronic
1123025513 14:105421864-105421886 GTGCCCGCAGGCCCGTCCCAGGG + Intronic
1127520639 15:59740069-59740091 CTGCCAGCAGGGCCGTGCCTTGG - Intergenic
1130650434 15:85759496-85759518 GTGCCAGCAGAGCCGTCCCCTGG + Exonic
1131013872 15:89041733-89041755 TGGTCAGCAGGGCAGACCGAGGG - Intergenic
1131200168 15:90388799-90388821 TTGCCTGCGGGGTAGACCCAAGG + Intronic
1132064069 15:98716029-98716051 CAGCCAGCATGGCAGCCCCAGGG + Intronic
1133755821 16:8761669-8761691 TTTCCAGCAGGACATGCCCAGGG + Intronic
1135861082 16:26056663-26056685 TTGGGAGCAGGGCAGTGGCAGGG - Intronic
1140479856 16:75256725-75256747 GAGCCAGCAAGGCAGCCCCAGGG + Intronic
1142025429 16:87810401-87810423 TTGCCTGCAGGACTGTCCCCAGG + Intergenic
1142066265 16:88064768-88064790 TTGCCCGCAGGGCACTCCTCTGG + Intronic
1142310595 16:89310294-89310316 TTGGTAGCAGGACAGACCCATGG - Intronic
1142382112 16:89738798-89738820 TTGCCAGCCAGGCAGGCACATGG + Intronic
1143037377 17:4007181-4007203 TGCCCAGAGGGGCAGTCCCAGGG + Intronic
1143373927 17:6456426-6456448 TGGCAAGGAGGGCAGTCGCAGGG - Intronic
1143411308 17:6711104-6711126 TTGCCAGGAGGTGACTCCCAGGG - Intronic
1143711233 17:8736614-8736636 AGGCCAGCAGGGCAGTTCCCAGG - Intronic
1146810959 17:35902853-35902875 TCTCCAGCATGGCAGTCTCAGGG - Intergenic
1147669087 17:42166360-42166382 GTGCCTGCAGGGCATCCCCACGG + Exonic
1148116457 17:45178139-45178161 TTGCCAGCCCGGCAGCCACAGGG - Intergenic
1149268463 17:54952801-54952823 GGGCCAGCATGGCAGTGCCATGG + Intronic
1151156034 17:72123533-72123555 TTGTCCACAGGGCAATCCCAGGG + Exonic
1151188713 17:72382242-72382264 ATTCCAGCAGGCCAGCCCCATGG + Intergenic
1151469848 17:74311259-74311281 TTGCCTGCAGGGCTGTCCACTGG - Intronic
1151704165 17:75758000-75758022 GGGCCTGCAGGCCAGTCCCACGG - Exonic
1151826670 17:76527706-76527728 TGGCCACCAGGGCAGCCCCGGGG - Exonic
1152263478 17:79279675-79279697 CAGCCAGCAAGGCACTCCCACGG + Intronic
1152799346 17:82323663-82323685 TGGCCAGCAGAGCAGCCCCCAGG - Intronic
1155261159 18:24043782-24043804 TTGCCACCAGGGCAGTTCTTGGG + Intronic
1157329511 18:46693064-46693086 TGCCCTGCAGGGCAGCCCCAGGG - Intronic
1160298516 18:77658511-77658533 CTGCCTGCAAGGCAGTTCCAGGG - Intergenic
1162448889 19:10742432-10742454 TTGTCAGCAGGACAAACCCAGGG - Intronic
1162971272 19:14182779-14182801 TGGCCAGCGGGGCAGTGCCAAGG + Intronic
1163197386 19:15732632-15732654 TTCCCAGCAGGTCATTCCCATGG - Intergenic
1163223667 19:15939635-15939657 TTCCCAGCAGGTCATTCCCATGG - Intergenic
1163368559 19:16889473-16889495 TTCCCACCAGGGCAGACCCCAGG + Intronic
1163698471 19:18775584-18775606 TGGCCAGCTGGGCAGGCCCGCGG + Intronic
1166288757 19:41848489-41848511 GTGCCAGCAGGACTGCCCCATGG - Exonic
925228933 2:2213269-2213291 TTGCCAGGAGGGGAAACCCAGGG + Intronic
927939849 2:27096623-27096645 CTGCCAGCAGTGCAGGCACAGGG + Intronic
928415245 2:31086313-31086335 TGCTCAGTAGGGCAGTCCCAAGG - Intronic
931637879 2:64357061-64357083 TTGGCAACAGGGCAGTCACTCGG - Intergenic
932484995 2:72079464-72079486 TCTCCAGCATGGCAGTCTCAAGG - Intergenic
933599451 2:84315149-84315171 TTCCCAACAGGACAGTCCGAAGG + Intergenic
934049865 2:88200944-88200966 TTTGGAGCAGGGCAGTCCCTGGG + Intergenic
935384386 2:102485732-102485754 TGGGCAGCAGGCCAGCCCCAGGG - Intronic
936010384 2:108921689-108921711 TTGAGACCAGGGCAGGCCCAGGG + Intronic
936622369 2:114113708-114113730 CTACCAGCAGGGCAGTCCCCAGG + Intergenic
937986271 2:127639542-127639564 TAGCCAGCAGGCCAGGCCCTAGG + Intronic
938138637 2:128779402-128779424 TTGCCATCAGACCACTCCCATGG + Intergenic
938344805 2:130559397-130559419 TTACAAGCAGGGCAGTGACAAGG - Intergenic
938345028 2:130561323-130561345 TTACAAGCAGGGCAGTGACAAGG + Intergenic
940065125 2:149619016-149619038 TTGGCAGCATGGCTCTCCCAAGG - Intergenic
942079266 2:172385025-172385047 ATGCCAGCGGGACAGTCCCCAGG - Intergenic
945841289 2:214890800-214890822 TTTCCAGCAAGGCAGCCTCAGGG + Intergenic
946008929 2:216549198-216549220 TTGACTGCAGGCCAGCCCCATGG - Intronic
947353442 2:229270262-229270284 TTGCAACCAGGGCAATCCCAAGG + Intronic
947577856 2:231291150-231291172 CTCCCAGCAGGGCAGGGCCAAGG - Intronic
948572931 2:238928664-238928686 TTGCCATCCTGGGAGTCCCAGGG + Intergenic
948844705 2:240677495-240677517 TTCCCAGGAGGGCAGGCCCAGGG + Intronic
948849155 2:240697384-240697406 TTCCCAGGAGGGCAGGCCCAGGG - Intronic
1169972107 20:11279222-11279244 CTCCCAGCATGGCAGTCTCATGG + Intergenic
1170603750 20:17860781-17860803 TTGGAAGCAGGGCAGTCCTGAGG + Intergenic
1171366837 20:24630747-24630769 TTCCCAGCAGGGGTGGCCCAAGG - Intronic
1171397132 20:24842679-24842701 TTCCCAGCAGGGCAGGGCCCTGG + Intergenic
1171490126 20:25510886-25510908 TGGCATGCAGGGCAGCCCCAAGG - Intronic
1172252691 20:33490573-33490595 TTGCCCGCCGGCAAGTCCCATGG - Intronic
1172502479 20:35437204-35437226 CTCCCACCAGGGCAGTGCCAGGG + Intronic
1177161712 21:17554876-17554898 TTGCCATCATGGCATTCACAGGG + Intronic
1178728186 21:35073910-35073932 TGCCCAGCGGGGGAGTCCCAAGG - Intronic
1179505569 21:41837830-41837852 TTCCCAGCAGGAAAGCCCCAGGG - Intronic
1179553249 21:42156618-42156640 TTGCCAGCAGTGTAGACCGAGGG - Intergenic
1180007778 21:45031113-45031135 TGGCCTGCAGGGAGGTCCCAGGG + Intergenic
1181617190 22:24062964-24062986 ATACCAGCAGGGCAGTTCCGAGG - Exonic
1183736795 22:39648919-39648941 TTGCGTGGAGGGAAGTCCCAGGG + Intronic
1183750793 22:39719271-39719293 GTGCCTGCTGGGCAGACCCAGGG - Intergenic
1184231022 22:43158509-43158531 TTGCCACCAGGGCAGAGCCTGGG + Intronic
1184239373 22:43203874-43203896 TTCCCTGAAGGGCAGTGCCATGG + Exonic
950113912 3:10438322-10438344 TTTCCAGCAGAGCTTTCCCAAGG + Intronic
952374871 3:32757768-32757790 TTACCAGCAAGGTTGTCCCATGG - Intronic
954630796 3:52046745-52046767 GTGCCGGCTGGGCAGTCCCAGGG - Intergenic
956774777 3:72555931-72555953 ATGGCAGCAGTGCAGTTCCAAGG + Intergenic
957080364 3:75631562-75631584 CTGCCAGCTGGGCCTTCCCAGGG + Intergenic
959169678 3:102830077-102830099 TTGCCAGCATCTCAGTCCCTCGG - Intergenic
963473637 3:145775856-145775878 TTGCCAGCTGGGTGGTCCTAGGG + Intergenic
968578164 4:1377517-1377539 TTGCCACCAGGGGTGCCCCAAGG + Intronic
968601147 4:1509855-1509877 GGGACAGCAGGGCAGCCCCAGGG + Intergenic
969098399 4:4751370-4751392 TTGCCAGCAGGGCTGTCACTTGG - Intergenic
969605125 4:8198588-8198610 TTCCCAGCCAGGCAGACCCAAGG - Intronic
969707717 4:8820851-8820873 TTGGCAGCAGGGCTGGCCCCTGG - Intergenic
972562044 4:40237492-40237514 TTCCCAGCTGGGGAGCCCCATGG + Intronic
979231358 4:118352431-118352453 TCGCCGGCGGGGCAGCCCCAGGG + Exonic
980969064 4:139552472-139552494 TGGCCAGCAGGACAGTCAGAGGG - Intronic
981621705 4:146707958-146707980 ATTCCAGCATGGCAGTCTCAGGG - Intronic
982158198 4:152541135-152541157 TTGCCAGCAGGGGAGCAGCATGG - Intergenic
984193356 4:176630271-176630293 TGCCCAGGAGGGCAGTGCCAGGG - Intergenic
986183049 5:5411514-5411536 TTGCCAGCAAGGCAGTCATGGGG - Intergenic
987717367 5:21589583-21589605 CTACCAACAGGGCAGTGCCAAGG + Intergenic
987765016 5:22214789-22214811 ATGTCATCAGGGCAGTCTCATGG - Intronic
989164185 5:38418488-38418510 TTGCTAGCAGGACAGAACCAGGG - Intronic
991318124 5:65335330-65335352 TTCCAAGCATTGCAGTCCCATGG - Intronic
991899754 5:71447935-71447957 ATGTCATCAGGGCAGTCTCATGG - Intergenic
991990386 5:72332793-72332815 TTGCCAGCATGGTAGCCACATGG + Intronic
993305772 5:86273005-86273027 TTGCCACCATCGCAGACCCATGG - Intergenic
994718586 5:103353409-103353431 TCTCCAGCATGGCAGTCTCAGGG - Intergenic
994976909 5:106819450-106819472 TTCCAAGCAGAGCAGTGCCAGGG + Intergenic
997337595 5:133119005-133119027 TTGGCTGCAGGGGACTCCCATGG + Intergenic
997587235 5:135050647-135050669 TTGCCAGCAGAGCTGGCGCAGGG + Intronic
997663365 5:135606716-135606738 TTGCCAGCAAGGGAGTTCCTTGG + Intergenic
997711108 5:136005711-136005733 TAGCCAGGAGGAGAGTCCCATGG - Intergenic
1005016240 6:21377886-21377908 CTGCCAGCTGGACATTCCCATGG - Intergenic
1005321517 6:24659908-24659930 TTTCCAGCATGGCAGTCTCAGGG - Intronic
1006988307 6:38191920-38191942 GTGCCACCAGGACAGTCGCATGG - Intronic
1007208776 6:40174349-40174371 ATGCCACCAGGTCAATCCCAGGG - Intergenic
1008067112 6:47061626-47061648 CTGCCAGCAGGGCAGTGCCCTGG + Intergenic
1015509562 6:134024311-134024333 TTGGCAGCAGGGCAGGCCGGAGG - Intronic
1017057990 6:150455125-150455147 TTTCCAGCAGGGCAACACCAGGG - Intergenic
1017682511 6:156878326-156878348 TTGCCAGAAGGGCAGGAACAAGG + Intronic
1018756485 6:166853761-166853783 AGGCCTGCAGGGCAGTCCCCAGG + Intronic
1018978948 6:168587711-168587733 TTGCCTGCAGGAAATTCCCATGG - Intronic
1019435312 7:1019590-1019612 CTGCCCACAGGGCAGCCCCACGG - Intronic
1026468108 7:70671830-70671852 TTGCAAACAGGCCAGGCCCAAGG - Intronic
1026627070 7:72004168-72004190 TTGGCAGCAGGACAGACACATGG + Intronic
1028210919 7:88073458-88073480 CTGACATCAGGGCAGTTCCAGGG - Intronic
1032265604 7:130368040-130368062 CTGGCTGCAGGGCAGTGCCAAGG + Intronic
1033222825 7:139540083-139540105 GTGACAGCAGGGCAGCCCCTGGG - Intronic
1034069143 7:148165807-148165829 TTGCCTGCAGGTTAATCCCAAGG - Intronic
1035672043 8:1425658-1425680 TTGCCATCAGGGCAGTCTCAGGG - Intergenic
1036068127 8:5407103-5407125 GTCCCAGGAGGGCAGTGCCAGGG - Intergenic
1040345698 8:46490824-46490846 TTGCCAGCAGACTTGTCCCAGGG + Intergenic
1042749214 8:72139884-72139906 CTGCCAGAAGGGCAGTACTAGGG - Intergenic
1048886841 8:138915748-138915770 TTGCAGGCAGGGCAGTGGCACGG - Intergenic
1049744281 8:144256587-144256609 TTCGCAGCAGGCCAGGCCCAGGG - Intronic
1058279189 9:103090011-103090033 CTGCCAGGAGGACAGTACCAAGG - Intergenic
1059696429 9:116734242-116734264 TTTCCTGCAGGCCAGTCCCAGGG + Intronic
1059799741 9:117738173-117738195 TTTCCAGGAGGGCAGACACAGGG + Intergenic
1060049914 9:120371306-120371328 ATGCCAGGTGGCCAGTCCCAAGG + Intergenic
1060397505 9:123326506-123326528 CTGCCAGGAGGGCAGGGCCACGG + Intergenic
1061020241 9:128009638-128009660 TGGCCAGCAGGGCCATACCATGG - Intergenic
1061836409 9:133332748-133332770 TTTCCCCCAGGGCAGTGCCAAGG - Exonic
1061858511 9:133456005-133456027 TTCCCAGCAGGGCAGGCTCCGGG - Intronic
1062159431 9:135071693-135071715 ATGCCTGCAGAGCAGCCCCATGG + Intergenic
1062345763 9:136114360-136114382 TTGTCAGCAGGGCAGTCACCGGG - Intergenic
1062432160 9:136531048-136531070 CAGCCAGCAGGGCAGTCGCCCGG + Intronic
1196057947 X:111376322-111376344 TTGCCAGCAGGCTGGTGCCAAGG - Intronic
1197748030 X:129946089-129946111 TAGTCAACAGGACAGTCCCAAGG - Intergenic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic
1199490000 X:148387553-148387575 TTGCCACCAGTGCAGAGCCAAGG - Intergenic
1200230423 X:154441209-154441231 GTGCATGCAGTGCAGTCCCATGG + Intronic
1201224872 Y:11809034-11809056 TTCCCAGCAGGGCTCTCCCATGG - Intergenic