ID: 923838041

View in Genome Browser
Species Human (GRCh38)
Location 1:237636325-237636347
Sequence CTGGGTAGACACTTAGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923838038_923838041 -1 Left 923838038 1:237636303-237636325 CCTTTAGAGAACAGTGTCAGCAC 0: 1
1: 0
2: 0
3: 13
4: 154
Right 923838041 1:237636325-237636347 CTGGGTAGACACTTAGTGCATGG 0: 1
1: 0
2: 1
3: 8
4: 145
923838037_923838041 3 Left 923838037 1:237636299-237636321 CCTGCCTTTAGAGAACAGTGTCA 0: 1
1: 0
2: 2
3: 10
4: 129
Right 923838041 1:237636325-237636347 CTGGGTAGACACTTAGTGCATGG 0: 1
1: 0
2: 1
3: 8
4: 145
923838036_923838041 25 Left 923838036 1:237636277-237636299 CCTCTGTTGTTAACTGCTTTGTC 0: 1
1: 0
2: 1
3: 19
4: 192
Right 923838041 1:237636325-237636347 CTGGGTAGACACTTAGTGCATGG 0: 1
1: 0
2: 1
3: 8
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923838041 Original CRISPR CTGGGTAGACACTTAGTGCA TGG Intronic
900892380 1:5458675-5458697 CTGGGAAGACAGTGACTGCATGG + Intergenic
901443861 1:9295074-9295096 CTGGGGAGACACGAAGTGCCTGG - Intronic
901633497 1:10659073-10659095 CTGGGTAGTCAAGTAGTGGATGG - Intronic
901828896 1:11880216-11880238 CTGTGTGGACACAGAGTGCAAGG + Intergenic
901873678 1:12153571-12153593 CAGGGTAGAGGCTTAGAGCAAGG - Intergenic
906396471 1:45470740-45470762 TTGGGTAGCCACTAGGTGCAAGG + Intronic
911265453 1:95737703-95737725 CTGGGTAGACACCTAGTAGTTGG + Intergenic
911666101 1:100554473-100554495 CTGGGTAGACACACAGTAGAGGG + Intergenic
912006279 1:104904755-104904777 CTTTGTAGACACTTACTGAATGG - Intergenic
912082691 1:105956903-105956925 ATGGATCGATACTTAGTGCATGG + Intergenic
912168953 1:107074413-107074435 CTGGGTAGATACTTAGTAATGGG - Intergenic
912540248 1:110409422-110409444 GTTGGAAGAAACTTAGTGCAAGG - Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
915616492 1:157043480-157043502 CTGGGCAGACTCTTGGGGCAAGG + Intronic
915848262 1:159292386-159292408 CTGGGTAGACAGTAATTACATGG - Intronic
923582941 1:235235873-235235895 CAGGGTAAATACTCAGTGCATGG + Intronic
923838041 1:237636325-237636347 CTGGGTAGACACTTAGTGCATGG + Intronic
1064476738 10:15698413-15698435 CTGGGTAGATACCTAGTACTGGG + Intronic
1064867774 10:19901178-19901200 CTGGGTAGACACCTAGTAATGGG + Intronic
1070409965 10:76130632-76130654 CTGGGTAGACACAGAAGGCAGGG - Intronic
1070549771 10:77481992-77482014 CAGGGTAGGCACTTTGTGCCAGG - Intronic
1070753758 10:78978961-78978983 CTGGGTATCCACTGAGTGCCAGG - Intergenic
1071054297 10:81491284-81491306 CTGGGTAGACACCTAGTAGTGGG + Intergenic
1074928538 10:118099280-118099302 ATGGGTAAGCACTTAGTGCCTGG - Intergenic
1079349022 11:19677176-19677198 ATGGGGAGACTCTTTGTGCAGGG - Intronic
1085536966 11:77227559-77227581 CTGAGTCCACACTTTGTGCAAGG - Intronic
1086571045 11:88285001-88285023 CTGGGAAGACACTTGCTGAAAGG + Intergenic
1087502603 11:98977483-98977505 CTGGGTAGATACTTAGTAGTGGG - Intergenic
1088240141 11:107765559-107765581 CTGGGTAGACACTCAGTGGTGGG - Intergenic
1090255101 11:125278444-125278466 CTGGGTAGACACTCAGCGCCAGG - Intronic
1090757807 11:129809206-129809228 CTGGGTAGATACCTAGTACTGGG - Intergenic
1091207538 11:133832010-133832032 CTTGGTAGACCCTCAGTACAGGG - Intergenic
1095734064 12:45537033-45537055 CTGGGTACACAGATAGTGCTCGG - Intergenic
1098780070 12:74676195-74676217 CTGGTTAGACAGTGGGTGCAGGG + Intergenic
1101960418 12:109245316-109245338 CTGGGTAGGCACTGAATTCAAGG + Intronic
1102606300 12:114070188-114070210 ATAGGTAGACACTTGGTCCATGG - Intergenic
1103605367 12:122082001-122082023 CTGGGGAGGAACTAAGTGCAGGG + Intronic
1103874154 12:124114476-124114498 GTGGGGAGACACTGAGTGCTTGG + Intronic
1110359929 13:74613087-74613109 CTGGGTCTACAGTTGGTGCACGG + Intergenic
1112595904 13:100806647-100806669 CTGGGTAGCCAAATAGTGAAGGG + Intergenic
1121268988 14:92625231-92625253 ATGGGGAGACACTTAGTCCAGGG + Intronic
1125211496 15:37220984-37221006 CTCACTAGACATTTAGTGCAGGG - Intergenic
1125213570 15:37242681-37242703 CTGGGTAGACACTCAGTAGTGGG - Intergenic
1131403596 15:92145779-92145801 CTGGGCAGACACTGAGGGGAAGG + Intronic
1132222709 15:100116927-100116949 CTGGGCAGACCCTTGGGGCAGGG + Exonic
1132469058 16:91849-91871 CTGGGCAGAGACTCAGAGCAGGG - Intronic
1133374915 16:5276931-5276953 CTGGGTAGATACTTAGTAGTGGG - Intergenic
1133484679 16:6208444-6208466 TTGAGTAGACATTTAGTGGAGGG + Intronic
1133956033 16:10444633-10444655 ATGGGGAGACACTTGGTCCAAGG + Intronic
1138907279 16:61352435-61352457 CTGGGTAGATACCCAGTGCTGGG - Intergenic
1138988762 16:62363988-62364010 CTGCTTACACACTTAATGCAGGG + Intergenic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1141559095 16:84854769-84854791 CTGGGTGGGCACTCAGAGCAGGG - Exonic
1148136125 17:45293047-45293069 CTGGGGAGGCACTGTGTGCAGGG - Intronic
1152521398 17:80858756-80858778 CTGGGAAGACATTTAGAGGAGGG + Intronic
1155592301 18:27441095-27441117 CTGGGTAGAGAGTCAATGCAGGG + Intergenic
1156301193 18:35837726-35837748 ATGGGGAGACACTTAGTCCAGGG - Intergenic
1159708711 18:71726378-71726400 CTGGGTAGATACTCAGTAGAGGG - Intergenic
1161262924 19:3347472-3347494 CTGGGTTGACACTGGGTGCTGGG - Intergenic
1163472503 19:17505673-17505695 CTGGGCAGCCACGCAGTGCAGGG - Exonic
1163805479 19:19394398-19394420 ATTGGTAGACTCTTGGTGCATGG + Intronic
1163990528 19:20995106-20995128 CTGGGTGCACACTGCGTGCAGGG - Intergenic
926060960 2:9804464-9804486 CTGTGTCCACACTTAGTGGAAGG - Intergenic
926197553 2:10772950-10772972 CTGGGCAGCCACTTAGGCCAGGG - Intronic
927107635 2:19841620-19841642 CTGGGGAGACAGATAGTGTAAGG + Intergenic
935007561 2:99094888-99094910 CTGGGTAGACACTCAGTAGTTGG - Intronic
936080386 2:109428949-109428971 CTGGCTCGCCACTGAGTGCAGGG + Intronic
936418614 2:112343342-112343364 CTGGGAGGAGACTTCGTGCAAGG + Intergenic
942393267 2:175518862-175518884 CTGGGTAGATACTCAGTAGAGGG - Intergenic
943258269 2:185625763-185625785 GTAGGTAGACAGTAAGTGCACGG + Intergenic
948468186 2:238162094-238162116 CTGGGCAGAAACTTGGTGCTTGG + Intronic
1169417770 20:5432455-5432477 CTGGGTAGACCCTTTCTTCAAGG + Intergenic
1169713944 20:8594550-8594572 TTGAGTAGCCACTTAGTGCCTGG + Intronic
1175233005 20:57487022-57487044 CTGGGTAGATACCTAGTACTGGG - Intergenic
1178300581 21:31449701-31449723 CTGGGCAGAAACTTTGTGGAGGG - Intronic
950841467 3:15972457-15972479 CTGGGTAGATACTTAGTAGTGGG - Intergenic
952434696 3:33261167-33261189 CTGGGTAGACACCTAGTAGTGGG + Intergenic
952842850 3:37662821-37662843 CTGTGTAGACAGTTGGTCCATGG + Intronic
953478196 3:43224178-43224200 CTGGGTAGACACATAAAGCATGG - Intergenic
954907301 3:54073728-54073750 ATGGGGAGACACTTAGTCCAAGG - Intergenic
956617337 3:71185582-71185604 CTGGGTAGACAGATAGTCCCAGG + Intronic
956819270 3:72938366-72938388 CTGAGTAGACACTGGGTTCAGGG - Intronic
957158944 3:76583688-76583710 CTGGGTAGAAACTGAGAGAAAGG - Intronic
959362347 3:105409186-105409208 CTGGGTAGATACCTAGTGGCGGG - Intronic
962435629 3:135363992-135364014 CTGGGGTGACAGTGAGTGCAAGG + Intergenic
965066284 3:163854680-163854702 CTGGGTGGACAAGTGGTGCATGG + Intergenic
966122824 3:176542048-176542070 CTGGGTAGACACCCAGTGGTGGG - Intergenic
969074772 4:4569240-4569262 TTGAGTAAAGACTTAGTGCAAGG - Intergenic
969868188 4:10088892-10088914 CTGGGCAGTCCCTTAGTGGAGGG + Intronic
970382345 4:15520635-15520657 CTGGTTTTACCCTTAGTGCAAGG - Intronic
971255703 4:25011502-25011524 CTGGGAAGCCACTTGGTGCTTGG + Intronic
976479110 4:85518868-85518890 CTGGGTAGATACCTAGTGGTGGG + Intronic
976996863 4:91444243-91444265 CTTGGTAGCCACTTAGAACAAGG + Intronic
980263471 4:130484519-130484541 CTGGGTAGACACTCAGTAGTGGG - Intergenic
983842848 4:172479152-172479174 CTGGGTAGATACTTAGTAGTGGG - Intronic
987154739 5:15077813-15077835 CTAGGTAGAGATTTATTGCAGGG + Intergenic
987550819 5:19379290-19379312 CTGGGTAGATACCTAGTGGTGGG - Intergenic
987661654 5:20886046-20886068 CTGGGTATACACTTAGTAATGGG - Intergenic
989471183 5:41820706-41820728 ATGGGGAGACACTTTCTGCATGG - Intronic
990704178 5:58509264-58509286 CTGGGTAGGTACTTAGTGGTGGG - Intergenic
990799121 5:59579706-59579728 CTGGGTACACACTTGGTGTGTGG - Intronic
991216140 5:64159156-64159178 ATGGGGAGACACTTAGTCCAGGG - Intergenic
993112234 5:83671929-83671951 CTCTGTTGAAACTTAGTGCAAGG - Intronic
994065766 5:95539894-95539916 CTGGGTAGATACCTAGTAGAGGG - Intronic
994521242 5:100839213-100839235 CTGGGTAAATACATATTGCAAGG + Intronic
995351180 5:111177502-111177524 CTGGGTAGATACCTAGTGGTGGG + Intergenic
997954690 5:138269891-138269913 CTGGGTAGACACTCAGTAGTGGG - Intronic
1005292279 6:24391568-24391590 GTGTGTAGACACTTACTACATGG + Intergenic
1006652566 6:35563711-35563733 ATGGGGAGACATTTAGTCCAGGG + Intergenic
1006713436 6:36096277-36096299 CTGGGTACACACTAAGATCACGG + Intronic
1007325143 6:41053780-41053802 CTGGGTAGAAGCTTAGTCCCAGG + Intronic
1009867531 6:69416054-69416076 CTGGGTAGACACCTAGTAATGGG - Intergenic
1010613749 6:77988246-77988268 TTGGGTAGACACCTAGTACTGGG - Intergenic
1011054021 6:83186251-83186273 CTGGGGAGACATTTATTTCAAGG + Intronic
1012836771 6:104279504-104279526 CTCAGTGGACACTTAGTGCTAGG + Intergenic
1015483133 6:133737907-133737929 CTGAGTAGAGATATAGTGCAAGG - Intergenic
1017335480 6:153253820-153253842 CTGGGTAAAAACTGAGTACAAGG + Intergenic
1018557016 6:165060521-165060543 ATGGGGAGGCACTTTGTGCAGGG + Intergenic
1019774017 7:2901659-2901681 CTGGGGAGACGCTTGGTGCTGGG - Intergenic
1020992564 7:15219089-15219111 TTGTGTAGATAATTAGTGCATGG - Intronic
1023657191 7:42435678-42435700 CTGGGTAGATACTTAGTAGTGGG + Intergenic
1024360394 7:48461974-48461996 ATAGGTAGATACTTGGTGCAGGG + Intronic
1026339487 7:69423161-69423183 CTGGTTAGACATTGAATGCATGG + Intergenic
1028266901 7:88736876-88736898 CTGAGTAGACAATAAGTGGATGG + Intergenic
1028844070 7:95460381-95460403 CTTCTTAGACACTTAGTGAATGG + Intergenic
1030389998 7:108915848-108915870 CTGGGTAGATACTTAGTAGTGGG + Intergenic
1032634173 7:133688245-133688267 CTGTGTAGGCACACAGTGCATGG + Intronic
1032857302 7:135846090-135846112 CTGGGTAGAAACTTACAGCTCGG + Intergenic
1035872311 8:3149444-3149466 CTGGCTAGAAGATTAGTGCAGGG - Intronic
1036193347 8:6691846-6691868 CTGGGTATACACTTAGTAATGGG + Intergenic
1036587396 8:10136880-10136902 CAGGGTGGACACTGAGTACAGGG - Intronic
1037729070 8:21508178-21508200 CTGGACACACACTTACTGCAAGG + Intergenic
1038510087 8:28125600-28125622 CTGGTTGGGCCCTTAGTGCAAGG + Intronic
1039074672 8:33679297-33679319 CTGGGTAGACACTCAGTAATGGG - Intergenic
1041200556 8:55449706-55449728 CCGTGTGGACACTGAGTGCAAGG - Intronic
1041212502 8:55566822-55566844 CTGGGTAGATACTTAGTAGTGGG - Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1047434771 8:124827138-124827160 CTGGGCAGACCCTTAGTGACAGG - Intergenic
1048334930 8:133495573-133495595 CTGGGTAGACAAAGAATGCAAGG + Intronic
1050400731 9:5250891-5250913 CTGGGTAGATATTTAGTAGAGGG - Intergenic
1052537619 9:29767241-29767263 CTGGGTAGACACCTAGTAGTGGG - Intergenic
1057437248 9:95052982-95053004 CTCGGTGCACACTTAGTGCTAGG + Intronic
1057834010 9:98429692-98429714 CTGGGAAGACACTGAGTGAATGG - Intronic
1060371047 9:123071857-123071879 CTGGGGAAACACTTGGTGTATGG + Intronic
1060809959 9:126606126-126606148 CGTGGTGGACACTCAGTGCATGG + Intergenic
1062732826 9:138119216-138119238 CTGGGTAGAAAAGTAGTCCAGGG - Intronic
1188469492 X:30521681-30521703 CTGTCTAGAAACTGAGTGCAAGG + Intergenic
1191224112 X:58022895-58022917 CTGGGTACACACTTAGTAATGGG - Intergenic
1193015800 X:76732756-76732778 CTGGGTAGACACCCAGTGGTGGG - Intergenic
1194602227 X:95936211-95936233 CTGGGTAGATACCTAGTGGTGGG + Intergenic
1196030625 X:111092048-111092070 CTGGGCAGGCACTGAATGCAAGG - Intronic
1197475830 X:126923736-126923758 CTGGGTAGACACTCAGTAGTGGG + Intergenic
1197475876 X:126924500-126924522 CTGGGTAGACACTCAGTAGTGGG + Intergenic
1198506869 X:137309647-137309669 CTGTGTAGGCACTTAGTGCAGGG - Intergenic
1198885534 X:141332243-141332265 CTAGGTAAGCATTTAGTGCATGG - Intergenic