ID: 923839848

View in Genome Browser
Species Human (GRCh38)
Location 1:237657995-237658017
Sequence CTCCCATGACAAATGGTCAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923839846_923839848 18 Left 923839846 1:237657954-237657976 CCTGAGAAATTGGAATACTTCAT 0: 1
1: 0
2: 0
3: 19
4: 242
Right 923839848 1:237657995-237658017 CTCCCATGACAAATGGTCAATGG 0: 1
1: 0
2: 1
3: 10
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923839848 Original CRISPR CTCCCATGACAAATGGTCAA TGG Exonic
906095024 1:43217062-43217084 CTTCCAGGACAAATGGACAAGGG + Intronic
906130318 1:43451790-43451812 CTCCAATTACAAATGGTAAGTGG - Exonic
906471692 1:46136178-46136200 ATCACAAGACAAGTGGTCAAGGG - Intronic
910479641 1:87644415-87644437 TTCCTTTGACAAATTGTCAAAGG + Intergenic
910673963 1:89799171-89799193 CTCCCCTGACAACAGGTCAGAGG + Intronic
911003021 1:93187003-93187025 CTACCATAAAAAATGTTCAATGG - Intronic
911405553 1:97433421-97433443 CTCCCTGGAGAAATGGTGAAAGG - Intronic
911687902 1:100798083-100798105 ATCACATGGCAAATGGGCAAAGG - Intergenic
912006070 1:104903229-104903251 CTCCCATGACATATGGGGATTGG + Intergenic
913577083 1:120186732-120186754 ATCCCCTTAAAAATGGTCAAGGG + Intergenic
914558995 1:148798168-148798190 ATCCCCTTAAAAATGGTCAAGGG + Intergenic
914613838 1:149332062-149332084 ATCCCCTTAAAAATGGTCAAGGG - Intergenic
916754494 1:167756005-167756027 CTCAAATGAGAAATGCTCAAAGG - Intronic
919112981 1:193242728-193242750 ATCGCATGACAAATGATAAAGGG - Intronic
919154652 1:193748334-193748356 TTCCCTTGTCAAATGGACAAGGG - Intergenic
921994636 1:221404900-221404922 CTCAGATGAAAAATGGTAAAAGG - Intergenic
922206970 1:223456444-223456466 CTCCCATGTCACAAGGTCAGAGG - Intergenic
923839848 1:237657995-237658017 CTCCCATGACAAATGGTCAATGG + Exonic
924077742 1:240358756-240358778 CTCCCATGACACATGGATTATGG + Intronic
1063282098 10:4641305-4641327 TTCCCATCACAGATGTTCAAGGG - Intergenic
1067558724 10:47289667-47289689 TTCTGATGACAAATGGACAAGGG - Intergenic
1070271174 10:74956454-74956476 CTCCCATGACCAATGGCATATGG - Intronic
1070727758 10:78803744-78803766 CCTCCATGACACATGGTCGAAGG + Intergenic
1071040560 10:81303797-81303819 CTCCATTGAAAAATGGGCAAAGG + Intergenic
1074116165 10:110458862-110458884 GTCCCAGGACAAATGGGCATTGG + Intergenic
1074371211 10:112902049-112902071 CTCCCGTGACAAATGAAAAATGG + Intergenic
1077268238 11:1662700-1662722 CACGTATGAGAAATGGTCAATGG + Intergenic
1077272644 11:1688918-1688940 CACGTATGAGAAATGGTCAATGG - Intergenic
1080191102 11:29550209-29550231 CTCCAATTAAAAATGGGCAAAGG - Intergenic
1080504744 11:32901642-32901664 CTCCCATGACAATTCTGCAATGG - Intronic
1081765437 11:45606864-45606886 TTCCCAGGATAAAAGGTCAAGGG + Intergenic
1083538490 11:63493317-63493339 CTCCAAAGAAAAATGGGCAAAGG - Intergenic
1084445895 11:69203308-69203330 CTCTCAGGACAAATGGGAAAAGG - Intergenic
1084722620 11:70917180-70917202 CTCCCTTGAAAAGTGGGCAAAGG + Intronic
1086185243 11:84005655-84005677 ATCCCATTAAAAATGGGCAAAGG + Intronic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1090176741 11:124656763-124656785 CTCCCAAAACAAAGGGCCAACGG + Intronic
1090729323 11:129556015-129556037 CTCCCATGGCAGAAGGTGAAAGG - Intergenic
1091356187 11:134939645-134939667 CTGCCAAAACAAATGGTCAAAGG + Intergenic
1091682518 12:2537193-2537215 CTCCCATGACAGATAGGAAAAGG + Intronic
1091893112 12:4077996-4078018 CTCCAATGAAAAGTGGGCAAAGG + Intergenic
1093123134 12:15296864-15296886 CTCCTATGAGAAATGCTAAAGGG + Intronic
1093246559 12:16745330-16745352 CTACCATCACAGATGGTGAAAGG - Intergenic
1094036655 12:26079280-26079302 ATCCAATTAAAAATGGTCAAAGG + Intronic
1094351322 12:29528673-29528695 CTCAAATGACAAATGGACATTGG + Intronic
1096035946 12:48470497-48470519 ACCCCATGAAAAATGGGCAAAGG - Intergenic
1096805751 12:54140240-54140262 CTCCCATGACCAATGTTCTGGGG - Intergenic
1099621663 12:85009121-85009143 CTCCCATGGCAGAAGGTGAAAGG + Intergenic
1100085264 12:90902668-90902690 CACCCATGAGCAATGGTGAATGG - Intergenic
1107678001 13:42816914-42816936 CTCCCTGGACAAATGGTTTAGGG - Intergenic
1114673110 14:24423558-24423580 CTCCCATGGCCCATGGTCAGCGG - Intergenic
1115126872 14:30006467-30006489 CTCACATGACAATTGCTCAAGGG - Intronic
1116292154 14:43057655-43057677 TTCCCATTAAAAATGGGCAAAGG - Intergenic
1117461514 14:55949910-55949932 TTCACATGATAAAGGGTCAAAGG + Intergenic
1119434174 14:74587074-74587096 ATCCCATGATTAATGGCCAAGGG + Intronic
1119564127 14:75614291-75614313 CTCACATGACAAATGTGCAGTGG + Intronic
1120149377 14:81016448-81016470 AACCCATTAAAAATGGTCAAAGG - Intronic
1120500535 14:85291719-85291741 CTCCCATAACAAAATGACAATGG - Intergenic
1120856097 14:89213733-89213755 CCCCCAGGACAAATGGGAAAGGG - Intronic
1121674770 14:95743398-95743420 CTAACATCACCAATGGTCAAAGG + Intergenic
1124583263 15:30981420-30981442 CTCACATGACACAAGGGCAAAGG + Intronic
1124806432 15:32888590-32888612 CTCCCATGAAAAATGGAAGAGGG + Intronic
1125410113 15:39397311-39397333 GTCCCATGAGAAAAGGTCACAGG - Intergenic
1127098744 15:55541192-55541214 CTCCCAAGACAAGTGGTATAGGG - Exonic
1131739020 15:95366378-95366400 CTCTAATGACAAATGGTGAGAGG + Intergenic
1134871857 16:17659215-17659237 CTCTCATTACAAATGGTCTTTGG + Intergenic
1138087219 16:54143996-54144018 CTCAGATGACAAAAGGTGAAGGG - Intergenic
1139445439 16:66995453-66995475 TTCCCATGACAGATGGGCCAGGG + Intronic
1140402094 16:74679863-74679885 CTCCCAGGAGAAATGGTTGAGGG + Intronic
1141956020 16:87371823-87371845 GTCCCATGACAAGTGGGGAAGGG + Intronic
1142514604 17:419149-419171 CTCCCATGACCCTTGGTCAGAGG - Intronic
1146090014 17:29867659-29867681 ATCCCCAGACAAATGTTCAAGGG - Intronic
1154498435 18:14979652-14979674 CTGCCAAAACAGATGGTCAAAGG - Intergenic
1157096039 18:44686213-44686235 CTCTCATGAGAAAGGGTAAAAGG - Intronic
1159294163 18:66460456-66460478 ATCCCATTAAAAATGGGCAAAGG - Intergenic
1159574730 18:70161664-70161686 ACCCCATTACAAATGGGCAAAGG + Intronic
1161017658 19:1991225-1991247 CTCCCACCACAAGTGGCCAAGGG - Intronic
1166666260 19:44682384-44682406 CTCCTCTGACAAATGGGCACTGG - Intronic
1167126433 19:47552373-47552395 GTTCCATGACAAATGGCCACAGG - Intronic
925713926 2:6767876-6767898 ATCCTATGACAAATGCACAAGGG - Intergenic
927160928 2:20260107-20260129 CCCAAATGACAAATGGACAAAGG - Intronic
927746424 2:25625935-25625957 CTCACATGACAAAGGGGCAAAGG - Intronic
932127754 2:69159852-69159874 CTCCAATGACAAATTGCAAAGGG + Intronic
933155364 2:78967221-78967243 CATCCATGACAAATTCTCAAGGG + Intergenic
934107320 2:88707433-88707455 CTTCCATTATAAATGCTCAATGG - Intronic
934525506 2:95049335-95049357 CTCCCCTGAGGAAGGGTCAAGGG - Intronic
934942164 2:98510557-98510579 CTCACATGACAAAAGGTGAAGGG + Intronic
935303511 2:101715035-101715057 CTGCCATAACAAAAGGTCACAGG + Intronic
936006071 2:108890001-108890023 CTCCCACAATAAATGCTCAAGGG - Intergenic
937086830 2:119177454-119177476 CTCCCATGGCCACTGGTGAATGG - Intergenic
940515844 2:154683094-154683116 CTCCCATGGCAGATGGTGGATGG - Intergenic
943276866 2:185878290-185878312 TTCCTATGAGAAATGCTCAAAGG + Intergenic
945039613 2:205733119-205733141 ATCCCATGGCAAATGGATAAGGG - Intronic
945723566 2:213448265-213448287 CATTCATGAGAAATGGTCAAAGG + Intronic
946649583 2:221876525-221876547 ATCCCATTAAAAATGGGCAAAGG - Intergenic
1170350381 20:15434341-15434363 ATCCCATAAAAAATGGGCAAAGG + Intronic
1170778733 20:19404382-19404404 CCCCCATGACAAGTGGGTAAGGG - Intronic
1170986479 20:21263947-21263969 CTCCTATAACAAATGATGAATGG - Intergenic
1171308538 20:24126707-24126729 ATCCCATTAAAAATGGGCAAAGG + Intergenic
1173235479 20:41241330-41241352 ATCCCATTAAAAATGGGCAAGGG - Intronic
1175490551 20:59378035-59378057 CTCCCATCAGCAATGTTCAAGGG + Intergenic
1176898365 21:14410514-14410536 CTCCATTGAAAAATGGGCAAAGG - Intergenic
1177811163 21:25926155-25926177 TTCCCGTAACAAATGGTCCAGGG - Intronic
1178057675 21:28817757-28817779 CTCCCAACACTAATGGCCAAGGG - Intergenic
1183784340 22:40020983-40021005 CTCCCAGGACATATGTTCACAGG - Intronic
952423050 3:33148549-33148571 TTCCCATGACAGCTGGTCATTGG + Intergenic
953994687 3:47510792-47510814 CTGCCAGGACAAAGTGTCAATGG + Intronic
955656481 3:61250498-61250520 CTCCCAGGTCAAGTGGCCAAAGG - Intronic
956091012 3:65667179-65667201 CTCCCATGAAGAAGGGGCAATGG + Intronic
957908869 3:86595081-86595103 CTCCCATGACACATGCTCCTTGG + Intergenic
957910142 3:86609405-86609427 CACTCATGACAAAAGGTGAAGGG + Intergenic
960559577 3:119068790-119068812 CTCACATGATAAAAGGACAATGG + Intronic
961642323 3:128372362-128372384 CTGCCATGGCAGCTGGTCAAGGG + Intronic
962652877 3:137514015-137514037 CTTCTTTGACAAATGTTCAATGG - Intergenic
963925448 3:150945801-150945823 CTCCCAAGAAAAATGCACAAGGG - Intronic
964535862 3:157720391-157720413 ATCCCATTAAAAATGGGCAAAGG - Intergenic
969328476 4:6458422-6458444 CTCACATGACAGAAGGGCAAGGG + Intronic
969951791 4:10844332-10844354 CTCTCAAGACAAATGGAAAAGGG + Intergenic
971907445 4:32745538-32745560 CTCACATGACAAAGGGACAAAGG + Intergenic
974508185 4:62804819-62804841 CTCCTACAAGAAATGGTCAAAGG - Intergenic
975058952 4:69973035-69973057 ATCCCATTAAAAATGGGCAAAGG - Intergenic
975234715 4:71979110-71979132 ATCCCATTAAAAATGGACAAAGG - Intergenic
975400237 4:73929059-73929081 CTCCCTTAAAAAATGGGCAAAGG + Intergenic
975516293 4:75251974-75251996 CTCACATGGCAAAATGTCAAAGG - Intergenic
976073804 4:81273513-81273535 CTCCCAAGTCAAGTAGTCAAGGG - Intergenic
976311565 4:83618443-83618465 CTTACATGAAAAATGTTCAAAGG - Intergenic
979959796 4:127004072-127004094 ATCCCATGACAGATGGTATACGG - Intergenic
983147040 4:164229440-164229462 CTCTCATGACTATTGGCCAAAGG - Intronic
984538545 4:181007502-181007524 TTCCCATGCGATATGGTCAAAGG + Intergenic
986000245 5:3625344-3625366 CTCCCATGACACATGGGAATTGG + Intergenic
986098263 5:4581593-4581615 CTCCCATGACAAATGGCCTCGGG - Intergenic
987615531 5:20269049-20269071 ATCCCATTAAAAATGGGCAAAGG + Intronic
993618794 5:90144380-90144402 CTCCCTTTACACATGATCAAGGG + Intergenic
994015748 5:94962988-94963010 CTCACATGGCAAAAGGTGAAAGG + Intronic
994614263 5:102083726-102083748 ATCCCATTAAAAATGGGCAAAGG + Intergenic
997204616 5:132038544-132038566 ACCCCATAAAAAATGGTCAAAGG - Intergenic
998966287 5:147544194-147544216 ATCCAGTGACAAATGTTCAATGG - Intergenic
999610849 5:153367949-153367971 CTCTCATGTCATCTGGTCAAAGG + Intergenic
1000642494 5:163719127-163719149 CTCCCTTAAAAAGTGGTCAAAGG + Intergenic
1001668669 5:173455311-173455333 CTCACATGACTGATGGTCACTGG - Intergenic
1001768078 5:174270545-174270567 GTCCCATGGCAAAAGGTGAAAGG + Intergenic
1002107992 5:176889617-176889639 CTGTCATCACAAATGGTCCATGG + Intronic
1002279563 5:178122484-178122506 CTCCCATGGCCAGTGGTCAGTGG + Exonic
1002408898 5:179058389-179058411 GTCCCATTAAAAATGGGCAAAGG - Intergenic
1003517207 6:6827158-6827180 CTCCCAGCACCACTGGTCAATGG - Intergenic
1005880268 6:30052454-30052476 ATCCCCTTAAAAATGGTCAAGGG - Intergenic
1007467632 6:42065713-42065735 CTCCCATGACAGATGGTCTCGGG - Intronic
1008119431 6:47594526-47594548 ATACCAAGAAAAATGGTCAAAGG - Intronic
1010456869 6:76066052-76066074 CCCCTATGAGAAATGCTCAAGGG + Intronic
1010496030 6:76534301-76534323 ATCCCATTAAAAATGGGCAAAGG - Intergenic
1011023626 6:82841800-82841822 ATCCTATGACACCTGGTCAATGG - Intergenic
1012038352 6:94171984-94172006 ATCCCATCAAAAATGGGCAAAGG + Intergenic
1018657601 6:166054497-166054519 CTTCCATGATAGATGGTGAAGGG - Intergenic
1028481132 7:91306220-91306242 GTCTCAAGACAAATGGTAAATGG - Intergenic
1030131147 7:106201603-106201625 CTCCCAAGAAAAATGGTTGAGGG - Intergenic
1030768312 7:113440124-113440146 GTCCTATGAGAAATGCTCAAAGG - Intergenic
1031247325 7:119331295-119331317 ATCCCATTAAAATTGGTCAAAGG - Intergenic
1031788450 7:126065975-126065997 CTCCCATGACAGATGGGGATGGG + Intergenic
1034068255 7:148157310-148157332 GTCCAATAACAACTGGTCAATGG + Intronic
1035933749 8:3813710-3813732 CTCCTATACCAAATGGTCCATGG + Intronic
1036617661 8:10401223-10401245 CCCCCTTGAAAAATGGGCAAGGG + Intronic
1038819645 8:30940711-30940733 ATCACATGACAGAAGGTCAAAGG + Intergenic
1038902521 8:31859871-31859893 CCACCATGGGAAATGGTCAAGGG - Intronic
1046576588 8:116037323-116037345 CTCCCATGACAAATGAAGACAGG - Intergenic
1048483172 8:134820604-134820626 GTTCCATGACAGAGGGTCAAGGG + Intergenic
1048743099 8:137584167-137584189 CTACCATGCCAAATGCTCATTGG + Intergenic
1048922360 8:139242846-139242868 CACTCATGACAGAAGGTCAATGG + Intergenic
1051933248 9:22412254-22412276 ATCCCATTAAAAATGGGCAAAGG + Intergenic
1056115715 9:83439303-83439325 AACCCATGACCAATGGCCAAGGG + Intronic
1059966542 9:119620222-119620244 ACCCCATTAAAAATGGTCAAAGG - Intergenic
1060303649 9:122391700-122391722 CTCCCATGACAAATGGTCCCCGG + Intronic
1060523486 9:124307746-124307768 GTCCCTTGACAAATGGTCCTGGG + Intronic
1187221306 X:17328684-17328706 CTCCCATGAGAAATGCTACAAGG - Intergenic
1187692987 X:21890212-21890234 CTCACATGAAAAATGGGCAAAGG - Intergenic
1188132745 X:26457849-26457871 CTCTCAGGACAAAAGGTAAATGG + Intergenic
1188911192 X:35849543-35849565 CTCACATGGCAAAAGGTAAAAGG - Intergenic
1189230209 X:39446205-39446227 CTTCCATGACTGATGGTCATAGG - Intergenic
1189727456 X:43982566-43982588 ATCCCATTAAAAATGGGCAAAGG + Intergenic
1190959555 X:55232770-55232792 ATCCCATTAAAAATGGGCAAAGG + Intronic
1191685962 X:63891300-63891322 ATCCCATTAAAAATGGGCAAAGG + Intergenic
1191968216 X:66784672-66784694 GTCTCATGAAAAATGGGCAAAGG + Intergenic
1192816557 X:74599603-74599625 CTCACATGGCAAAAGGACAAAGG - Intronic
1193523747 X:82563194-82563216 CTCCATTAAAAAATGGTCAAAGG + Intergenic
1194783643 X:98056095-98056117 GTCCCTTGAGAAATGGTGAAGGG - Intergenic
1196207294 X:112955303-112955325 CTCCCATGAGAAAAGCTCTATGG + Intergenic
1197554127 X:127933705-127933727 AACCCATGACAATTGGTTAAGGG - Intergenic
1197733726 X:129834130-129834152 CTCCCTTGCCAAAGGGGCAAGGG - Intronic
1199888665 X:152051074-152051096 CTCCATTTACAAATGGTCAATGG - Intergenic
1201669454 Y:16501097-16501119 TTTCCATGACAAATCTTCAAAGG - Intergenic
1201967810 Y:19757464-19757486 ATCCCATTAAAAATGGGCAAAGG - Intergenic