ID: 923847517

View in Genome Browser
Species Human (GRCh38)
Location 1:237752279-237752301
Sequence GTGCACCTGTAGGCCCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923847517_923847525 19 Left 923847517 1:237752279-237752301 CCCACCTGGGCCTACAGGTGCAC No data
Right 923847525 1:237752321-237752343 TTTAGTTTTTTGTAGAGACAGGG 0: 29
1: 959
2: 7834
3: 32804
4: 157433
923847517_923847524 18 Left 923847517 1:237752279-237752301 CCCACCTGGGCCTACAGGTGCAC No data
Right 923847524 1:237752320-237752342 TTTTAGTTTTTTGTAGAGACAGG 0: 32
1: 1071
2: 9937
3: 52840
4: 290058
923847517_923847521 -9 Left 923847517 1:237752279-237752301 CCCACCTGGGCCTACAGGTGCAC No data
Right 923847521 1:237752293-237752315 CAGGTGCACACCACGAAGCCTGG 0: 1
1: 87
2: 2635
3: 14347
4: 43777

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923847517 Original CRISPR GTGCACCTGTAGGCCCAGGT GGG (reversed) Intronic
No off target data available for this crispr