ID: 923851231

View in Genome Browser
Species Human (GRCh38)
Location 1:237797430-237797452
Sequence CATTGTGGCCAGAGAGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923851231 Original CRISPR CATTGTGGCCAGAGAGTTGA AGG Intronic
901006914 1:6176332-6176354 CACTGGGGCCAGAGAGGTAACGG + Intronic
901557898 1:10046089-10046111 CATTCTGGCCAGAGAGGGGAGGG + Intronic
901732092 1:11287306-11287328 CTTTGTGGAAAGATAGTTGAGGG + Exonic
902419963 1:16271165-16271187 CAATGAGGTCAGAGAGATGAGGG + Intronic
902571839 1:17352111-17352133 GACTGTGGTCAGAGAGGTGATGG + Intronic
904561079 1:31397675-31397697 CAGTGAGGCCAGGAAGTTGAGGG - Intergenic
906909113 1:49927081-49927103 CAATGTGGCCAGAATGTTGCAGG - Intronic
907431614 1:54415378-54415400 CTGTGTGCCCAGAGAGGTGAAGG - Intergenic
907495597 1:54842136-54842158 CATGGGGGCCAGAGAGCAGATGG + Exonic
908841746 1:68287154-68287176 ATTTGTAGCCATAGAGTTGATGG + Intergenic
909096614 1:71295892-71295914 CATTGTGGTTTGAGATTTGAAGG - Intergenic
909599606 1:77448102-77448124 CACTGTGGACAGCGGGTTGATGG + Intronic
910191994 1:84604327-84604349 CATTGTGTACAGAGAGGGGATGG - Intergenic
911484333 1:98486717-98486739 CATTTTCTCCAGAGAGCTGAAGG + Intergenic
912528918 1:110306141-110306163 CATTGTGGCCAGACCTTTGCAGG + Intergenic
915445468 1:155972176-155972198 CATTGATGCCAGAGAGAGGAAGG - Intronic
915628892 1:157137080-157137102 CCTTCTGGCCAGTGAGTGGAAGG + Intronic
916140293 1:161691498-161691520 CATGGTGAGCTGAGAGTTGAAGG + Intergenic
917435964 1:175021675-175021697 GAGAGGGGCCAGAGAGTTGATGG - Intronic
918294672 1:183145125-183145147 CATTGTGGCCTGAGACTTGCTGG - Exonic
918911312 1:190574358-190574380 CATTGTGTACTGAGATTTGATGG - Intergenic
919976306 1:202615299-202615321 CAGTGGGCCCAGAGAGTGGATGG + Intronic
923295350 1:232589708-232589730 AGTTGTTGACAGAGAGTTGAGGG - Intergenic
923851231 1:237797430-237797452 CATTGTGGCCAGAGAGTTGAAGG + Intronic
1065895374 10:30158669-30158691 CAAGGTGGCCAGAGAGATGAAGG - Intergenic
1066247223 10:33595276-33595298 CAATGTGGACATAGAGTGGAAGG + Intergenic
1066377814 10:34873766-34873788 CCTTGTGTCCAGTGAATTGATGG - Intergenic
1069856201 10:71442589-71442611 CATTGAGGCCAGAGGGGAGAAGG - Intronic
1070150090 10:73800160-73800182 CAGTGTGGCCTGTGAGTTGTGGG + Exonic
1071242489 10:83723364-83723386 ATTTGAGGCCAGAGAGTTAAAGG + Intergenic
1071299500 10:84245603-84245625 CATTGAGGGCAGAGAGCTGAAGG - Intronic
1071687375 10:87774169-87774191 TTTTGTGGCCAGAGGGTTTAAGG - Intronic
1073052074 10:100673826-100673848 GATTGTGGCCATAGACATGAAGG + Intergenic
1073650477 10:105353130-105353152 GAACGTGGCCAGAGAGGTGATGG - Intergenic
1076062049 10:127420521-127420543 CACTGTGTAAAGAGAGTTGAGGG + Intronic
1076947449 10:133660832-133660854 AATGGTGACCTGAGAGTTGAGGG - Intergenic
1078154645 11:8788773-8788795 AATTGTGGTCAGACAGTAGAGGG - Intronic
1079130630 11:17744959-17744981 CATTGGGGCCTGAGAGGTGTGGG + Intronic
1085065097 11:73488016-73488038 CAGTGTTGGCAGAGAGTAGACGG - Intronic
1086032689 11:82379176-82379198 TATAGTGGCCAAAGAGTTGTTGG - Intergenic
1086181959 11:83962979-83963001 CATTGTTGCCAGAGAGTAGATGG + Exonic
1087250045 11:95888794-95888816 AATTCTGGCCAGAAAGTTCAGGG + Intronic
1089417947 11:118308320-118308342 CATTGTTTCCTAAGAGTTGAGGG + Intronic
1089698614 11:120230832-120230854 CATGCAGGCCAGAGGGTTGAGGG + Intergenic
1090660025 11:128875580-128875602 CATGGAGGCCAGAGAGTAAAGGG + Intergenic
1091143862 11:133260207-133260229 CATTGGGGCCAGTGAGTGGAGGG + Intronic
1091815970 12:3438189-3438211 CATTGTGTTCAGAGAGGTGGAGG + Intronic
1091896350 12:4108321-4108343 CATTGTGGGATGGGAGTTGAAGG - Intergenic
1091996826 12:5000464-5000486 CATCGTTACCAGAGAGGTGAGGG - Intergenic
1092306896 12:7310618-7310640 CATTGTGGCCAGTGAGGAGGTGG + Exonic
1092587002 12:9910121-9910143 AATTTTGGCCAGAAAATTGAGGG + Intronic
1096419935 12:51448455-51448477 CATTGTAGATAGAGATTTGAAGG + Intronic
1096530910 12:52242421-52242443 CATGGTGGCAGGACAGTTGATGG + Intronic
1096658515 12:53106372-53106394 CCTAGTGGCCAGAGAAATGAGGG + Intronic
1098992804 12:77083522-77083544 ACTTGAGCCCAGAGAGTTGAGGG + Intergenic
1099080637 12:78175849-78175871 TATTGTGGGCATAGAGATGAAGG + Intronic
1101810533 12:108103896-108103918 CATGGTGGCCAGAGTTGTGATGG - Intergenic
1102997196 12:117360234-117360256 CACTGTGACCAGAGAGCTCATGG - Intronic
1104928383 12:132325543-132325565 CACTGTGGCCAGCCAGTTGCTGG - Intronic
1105777453 13:23676920-23676942 TATTTTTGTCAGAGAGTTGATGG - Intergenic
1107611252 13:42115499-42115521 GATAGTGGCCAGAGCTTTGAAGG + Intronic
1108006080 13:45947993-45948015 GATTGTGGCCATATAGTTAAAGG + Intergenic
1108574426 13:51779240-51779262 AATGGGGGCCAGAGTGTTGAAGG - Intronic
1110458566 13:75718309-75718331 TATTGTGGCCTTAAAGTTGAGGG + Intronic
1110744173 13:79033231-79033253 CTCTGTGGGCAGAGAGCTGAGGG - Intergenic
1111947127 13:94677748-94677770 GATTGAGGCCAGATAGTGGAAGG + Intergenic
1113229283 13:108194936-108194958 CACTGTGGACAGAATGTTGATGG + Intergenic
1113336435 13:109380899-109380921 TATTGTGACCAGAGTCTTGAAGG + Intergenic
1115728239 14:36240040-36240062 CATTGTGGGGAGTGAGTTGAGGG + Intergenic
1115782676 14:36786922-36786944 CATAATTGCCAGAGAGGTGAGGG - Intronic
1117090757 14:52247736-52247758 CAGTGTGGCCAGAGAAGTCAGGG + Intergenic
1120043483 14:79779675-79779697 ACTTGTGGTCAGAGAGTTGATGG - Intronic
1121298095 14:92846546-92846568 CATAGTGGTCAGAGAGATGAGGG - Intergenic
1124491953 15:30163650-30163672 CAGTGGGCCCAGAGAGTGGATGG + Intergenic
1124751584 15:32374667-32374689 CAGTGGGCCCAGAGAGTGGATGG - Intergenic
1125310650 15:38374892-38374914 CAGTGTGGCCAGAGCTCTGAAGG - Intergenic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129328976 15:74816996-74817018 CATTGAGCCCAGAGAGGGGAAGG + Intronic
1130234604 15:82122522-82122544 CATTCTGGGCAGAATGTTGATGG - Intergenic
1130543349 15:84837989-84838011 CACTATGGCCAGAGAGGTAAGGG + Intronic
1130602511 15:85285983-85286005 CATGGAGGCCAGAAAGTTGGAGG + Intergenic
1130766377 15:86875668-86875690 CATGGAGGCCAGAAAGTTGGAGG - Intronic
1132880746 16:2160741-2160763 CAGAGAGGCCAGAGAATTGAAGG + Intronic
1132957319 16:2601810-2601832 CACTGTGGGCAGGGAGTTGGGGG - Exonic
1134024453 16:10943221-10943243 CAGTGTGGCCTGAGATTTAAAGG - Intergenic
1135231403 16:20711552-20711574 CATTGTGGCCAGTGAGGAGGTGG + Intronic
1135896369 16:26408327-26408349 AATAGTTGCCAGAGATTTGAGGG + Intergenic
1137054314 16:35736041-35736063 CAGTGGGGCCAGAGAGTCAAGGG - Intergenic
1137455560 16:48615232-48615254 CATGGTTGTCAGAGAGATGATGG - Intronic
1137759688 16:50930320-50930342 CACTGTGACCAGAGGCTTGAAGG + Intergenic
1138013835 16:53411830-53411852 CATTGTTGCCAGAGATTTGGAGG + Intergenic
1138976476 16:62214194-62214216 CATTGTAGACAGAGATTTGGTGG - Intergenic
1140244983 16:73239929-73239951 CATTGTGACCAGAGGCTTGCAGG - Intergenic
1143026374 17:3944101-3944123 CATTCAGGCCAGAGAGATGCGGG - Intronic
1143316688 17:6038264-6038286 CAGTGTGGCCAGAGCGGGGAGGG + Intronic
1143490881 17:7284648-7284670 CATTGATGCCAGAGAGCTGCTGG - Exonic
1149072723 17:52562137-52562159 TATTGTGACAAGAGTGTTGACGG + Intergenic
1151700950 17:75742353-75742375 CATTGTGGACACAGTGCTGATGG + Exonic
1152564952 17:81096249-81096271 CATGGTGGGCAGAGAGCTCAGGG - Intronic
1153124997 18:1780292-1780314 CTTCTTTGCCAGAGAGTTGACGG - Intergenic
1159226983 18:65552158-65552180 CATTGTCTCCAGAGACTTCACGG - Intergenic
1159703935 18:71663532-71663554 CAGTGTGGCCATGGAGGTGATGG + Intergenic
1160449081 18:78949631-78949653 CATCGTGCCATGAGAGTTGAAGG - Intergenic
1166335537 19:42104432-42104454 CATTCTGGCAAAAGAGTAGAAGG + Intronic
1166390795 19:42407777-42407799 CATGTTGGCCAGAGACTGGAGGG + Exonic
1166976597 19:46608516-46608538 CATGATGGCCAGAAAGATGAAGG + Exonic
1167141782 19:47656446-47656468 CATTGTGGCCAGAGGCTTTCAGG + Intronic
1167798102 19:51723986-51724008 CTCTGTGGCCAGAGAGCTGGAGG + Intronic
1168687770 19:58358683-58358705 CATTGTGTCCTGAGAACTGAAGG - Intronic
925177341 2:1794877-1794899 CATTTTGGCCAGGGCTTTGATGG - Intronic
925488631 2:4367015-4367037 CCTTGAGGCCAGGGAGTTCAAGG + Intergenic
925722009 2:6838667-6838689 CACTGAGGCCAGAGAATTTATGG + Intergenic
926350489 2:11989665-11989687 TTTTGTGGCCCCAGAGTTGAGGG + Intergenic
927104694 2:19813034-19813056 CCTTGTGGCCAGAGGCCTGATGG - Intergenic
927192865 2:20528767-20528789 CTCTGTGGGCAGAGAGGTGAAGG + Intergenic
932598162 2:73107029-73107051 AATGGTGGCCAGAGAGGAGAGGG - Intronic
933805061 2:85992759-85992781 GGTTGTGGGCAGAGAGTAGATGG - Intergenic
935047842 2:99498010-99498032 AACTGTGGCCAGAAAATTGAGGG - Intergenic
935442727 2:103121307-103121329 CTTTGTGGCCAGGGAGATAATGG - Intergenic
936401234 2:112165965-112165987 GATTCTAGCCAAAGAGTTGAAGG + Intronic
937492796 2:122387489-122387511 TGTTCTGGCCAGACAGTTGAAGG + Intergenic
938710463 2:133972291-133972313 CATTGTGGCCTGAGAATGCAGGG + Intergenic
941677535 2:168359933-168359955 CCTTATGGCCAGAAAGTTTATGG + Intergenic
944931487 2:204524778-204524800 TATTGGGGCCAGAGAGATGTAGG + Intergenic
945141201 2:206688152-206688174 TATTGTGGCCAGAGGCTTGCAGG - Intronic
1168912317 20:1458785-1458807 CACAGAGACCAGAGAGTTGAAGG + Intronic
1168924288 20:1566606-1566628 AACTGAGGCCAGAGAGTTTAGGG + Intronic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1173407701 20:42780963-42780985 CATTGGAACCAGAGAGTTCAAGG - Intronic
1174477339 20:50805333-50805355 CAGATTGGCCAGAGACTTGAAGG + Intronic
1175570242 20:60012615-60012637 CAAGCTGGCCAGAGAGCTGAGGG - Exonic
1175680762 20:60986870-60986892 GCTTGTGGCCAGAGAGGTGCTGG + Intergenic
1176911623 21:14572061-14572083 CATTGTGGCCACACAGCTCAGGG + Intronic
1178375981 21:32067796-32067818 CATGGTGGCAACAGAGGTGATGG - Intergenic
1178541205 21:33452285-33452307 CATGGTGGTCTGAGAGTGGAGGG + Intronic
1182901869 22:33905146-33905168 CCTTGTGCCCAGGAAGTTGAGGG - Intronic
1184762344 22:46551646-46551668 CCGTGTGGCCAGAGAGCTGGAGG - Intergenic
952341655 3:32452280-32452302 CTTTCTGGCCAGAGACATGAAGG + Intronic
954025577 3:47781053-47781075 CTGTGTGGCGTGAGAGTTGATGG - Intronic
955772827 3:62403557-62403579 CTTTGGTGCCAGAGAGATGAGGG + Intronic
958061105 3:88482232-88482254 GAATGTGGCAAGAGATTTGAGGG - Intergenic
959447467 3:106458060-106458082 TGTTGTGGTCAGAGAGCTGATGG + Intergenic
962721461 3:138179068-138179090 CATTGTGTCCAGAGTGATGTTGG + Intergenic
963847031 3:150169990-150170012 AGTTGTGGCCAGAGAGTTCCTGG - Intergenic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
966257084 3:177929384-177929406 CCTTCTGGCCAGTGAGTGGATGG + Intergenic
967787836 3:193516499-193516521 CATTGCTGCCAGTGTGTTGAGGG - Intronic
969385195 4:6840335-6840357 CTTTGTGGCCAAAGGGATGATGG + Intronic
969701583 4:8770605-8770627 CTTTGTGGCCAGAGGGCTGTGGG + Intergenic
970670873 4:18395533-18395555 TATCCTGCCCAGAGAGTTGAAGG + Intergenic
976147323 4:82054837-82054859 CTTCCTGGACAGAGAGTTGATGG - Intergenic
976783239 4:88785795-88785817 CAGTGTGGGCTGGGAGTTGAAGG + Intronic
979876635 4:125899565-125899587 CAGGGTGGCCAGAGAGATAATGG - Intergenic
981379334 4:144054710-144054732 CATTTTGGCCAGGCAGGTGAGGG + Intergenic
982166456 4:152617875-152617897 CAGTGTGGCCTGAGAGTGCAAGG - Intergenic
983131126 4:164021346-164021368 CATTTTATCCACAGAGTTGATGG - Intronic
983824768 4:172245361-172245383 CACTGTTGCCATAGACTTGATGG + Intronic
985450904 4:190061632-190061654 AATGGTGACCTGAGAGTTGAGGG - Intergenic
986252609 5:6074438-6074460 CAATGTGGCCATAGTGTTCATGG - Intergenic
988200878 5:28066825-28066847 CATTGTAGACAGAGTTTTGATGG + Intergenic
988596737 5:32600397-32600419 CATTTTAGCCTGATAGTTGACGG + Intronic
992892150 5:81213398-81213420 CATTGGTGCCAGAGAATAGAAGG + Intronic
995332911 5:110965577-110965599 CAGTGTGGACAGAGATTTGCAGG + Intergenic
998231905 5:140366243-140366265 CATGGTACCCAGAGAGTTCAAGG + Exonic
1001241917 5:170077774-170077796 CATGGAAGCCAGAGAGATGATGG - Exonic
1006055329 6:31379680-31379702 CATAGTTGCCAGAGGGTGGAAGG + Intergenic
1010178953 6:73062416-73062438 CATTGTGGCCAGAAACTTCTAGG - Intronic
1011095009 6:83651584-83651606 CATTGTGGTCTGAGAGCAGATGG + Intronic
1011763612 6:90594827-90594849 CATTGCGGCGAGGGAGTTTAGGG + Intergenic
1014799874 6:125766838-125766860 CAGTGTGGCCAGATAATTCATGG - Intergenic
1014919908 6:127201929-127201951 CATCATAGCCAGATAGTTGACGG - Intergenic
1015438541 6:133219762-133219784 TATTGTGACCAGAGACTTGTAGG + Intergenic
1015595474 6:134862078-134862100 CATTGTGACCAGAGACTTGCAGG - Intergenic
1016920390 6:149287156-149287178 TTTTGTGGCTACAGAGTTGAAGG - Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1024606280 7:51025060-51025082 CAATGGGGCCAGAGGGTTGGAGG - Intronic
1026907320 7:74069942-74069964 CATCCAGGCCAGCGAGTTGAAGG - Intergenic
1028850751 7:95534597-95534619 CATCGAGGGCAGAGAGTGGAGGG - Intronic
1029310901 7:99663158-99663180 CTTTCTGGCCAAAGAGTTGCCGG + Intronic
1030576986 7:111300454-111300476 CAATGTGGCTAGAGAGTACATGG - Intronic
1030617915 7:111757599-111757621 CCTTGTGCCCAGAGATTTGATGG - Intronic
1031149972 7:118042194-118042216 GGTTGAGGCCAGAGAGTTGATGG - Intergenic
1031975537 7:128091300-128091322 CACTTGGGCCAGGGAGTTGAAGG - Intronic
1035962776 8:4156259-4156281 AATTATGGCTAAAGAGTTGATGG + Intronic
1037311148 8:17558073-17558095 GATAGTTGCCAGAGAGCTGAGGG + Intronic
1038443360 8:27586675-27586697 AATTGTGGCCAGAGATCTGAAGG + Intergenic
1038561970 8:28588635-28588657 CCTGGAGGCCAGAGAGGTGAGGG + Intergenic
1040747635 8:50664600-50664622 CATGGTGCCCAGAGAGATGAGGG - Intronic
1041532327 8:58883274-58883296 AACTGAGGCCAGAGAGTTTAAGG - Intronic
1042297199 8:67233796-67233818 CATTTTGGCTAGACTGTTGAAGG - Intronic
1044015613 8:87046131-87046153 CACTGCGGCTAGAGAGTTTATGG + Intronic
1044199782 8:89420903-89420925 GAGTGGGGCCAAAGAGTTGATGG + Intergenic
1045423838 8:102043375-102043397 AATTGTTTCCATAGAGTTGACGG + Intronic
1047852597 8:128874719-128874741 CATTGTGGTTAAAGAGTTAAAGG - Intergenic
1048055137 8:130855752-130855774 TATTTAGGGCAGAGAGTTGACGG - Intronic
1049341597 8:142115356-142115378 TCTTGTGGCCAGAGAGCTGCAGG - Intergenic
1050596880 9:7212966-7212988 CATTATGTCCAGAGTATTGAAGG + Intergenic
1051144912 9:14016686-14016708 AATTGGGCTCAGAGAGTTGAAGG + Intergenic
1051570246 9:18548594-18548616 TGTTGTGACCAGAGACTTGAAGG + Intronic
1052786146 9:32830469-32830491 CAGTGTGGCCAGGAAGTTCAGGG + Intergenic
1053543928 9:39003306-39003328 CACTGTGCCCAGGGAGTTGATGG - Intergenic
1053808359 9:41826803-41826825 CACTGTGCCCAGGGAGTTGATGG - Intergenic
1054622233 9:67360625-67360647 CACTGTGCCCAGGGAGTTGATGG + Intergenic
1055339883 9:75269970-75269992 CATTGTCTCCAGAGTTTTGATGG + Intergenic
1058380238 9:104369928-104369950 CATGTTGCCCAGAGACTTGATGG + Intergenic
1058472636 9:105297008-105297030 CATTGTGGCGTAAGAGATGAAGG - Intronic
1058566558 9:106291664-106291686 CAATGTGGCCACAGGGTTGATGG + Intergenic
1059420495 9:114187555-114187577 CCTTGAGGTCAGACAGTTGAGGG - Intronic
1061164237 9:128913194-128913216 GACTTTGGCCAGAGAGTTAAGGG + Intronic
1061678700 9:132232080-132232102 CATTGTGGCCAGACGGCTGCAGG + Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1187255610 X:17639184-17639206 CATTATAGCCAGAGCCTTGAGGG + Intronic
1188430407 X:30100612-30100634 CATTTTGACCATAGACTTGAAGG + Intergenic
1189559805 X:42180649-42180671 CATTGTGACCAGGGACTTGCAGG + Intergenic
1190451295 X:50583727-50583749 TCTTGTGGCCATAGAGCTGAGGG - Intergenic
1193658775 X:84231187-84231209 GCTTGTGGCCAGAGAGGTGGAGG + Intergenic
1196050303 X:111297426-111297448 CATTGTACCCAGAGTATTGAAGG + Exonic
1197999074 X:132413179-132413201 CGTTGTGGCAAGTGAGTGGATGG - Intronic
1199467513 X:148155867-148155889 TATTGTGGCCATAGAGTTTGTGG + Intergenic
1199601414 X:149543558-149543580 GATTGTGGCCATAGAGATTATGG + Intronic
1199648962 X:149935926-149935948 GATTGTGGCCATAGAGATTATGG - Intronic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1201337682 Y:12897884-12897906 CACTGAGGCTAGAGAGTTTATGG - Intergenic