ID: 923858607

View in Genome Browser
Species Human (GRCh38)
Location 1:237870820-237870842
Sequence CCCAGCCACATGCTGTAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923858607_923858615 23 Left 923858607 1:237870820-237870842 CCACTTTACAGCATGTGGCTGGG No data
Right 923858615 1:237870866-237870888 GAGAATGAGTGAGTGCCAGATGG No data
923858607_923858612 -10 Left 923858607 1:237870820-237870842 CCACTTTACAGCATGTGGCTGGG No data
Right 923858612 1:237870833-237870855 TGTGGCTGGGACCCAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923858607 Original CRISPR CCCAGCCACATGCTGTAAAG TGG (reversed) Intergenic
No off target data available for this crispr