ID: 923859373

View in Genome Browser
Species Human (GRCh38)
Location 1:237877554-237877576
Sequence CTTGTCATGGCCAAGGTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923859367_923859373 24 Left 923859367 1:237877507-237877529 CCAACCACTGTGCTTGAAATGAG 0: 1
1: 0
2: 0
3: 23
4: 177
Right 923859373 1:237877554-237877576 CTTGTCATGGCCAAGGTACTTGG 0: 1
1: 0
2: 1
3: 8
4: 116
923859365_923859373 29 Left 923859365 1:237877502-237877524 CCTTCCCAACCACTGTGCTTGAA 0: 1
1: 0
2: 1
3: 17
4: 197
Right 923859373 1:237877554-237877576 CTTGTCATGGCCAAGGTACTTGG 0: 1
1: 0
2: 1
3: 8
4: 116
923859368_923859373 20 Left 923859368 1:237877511-237877533 CCACTGTGCTTGAAATGAGAAAT 0: 1
1: 0
2: 0
3: 22
4: 270
Right 923859373 1:237877554-237877576 CTTGTCATGGCCAAGGTACTTGG 0: 1
1: 0
2: 1
3: 8
4: 116
923859366_923859373 25 Left 923859366 1:237877506-237877528 CCCAACCACTGTGCTTGAAATGA 0: 1
1: 0
2: 0
3: 21
4: 152
Right 923859373 1:237877554-237877576 CTTGTCATGGCCAAGGTACTTGG 0: 1
1: 0
2: 1
3: 8
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923859373 Original CRISPR CTTGTCATGGCCAAGGTACT TGG Intergenic
905676600 1:39830262-39830284 CTTATCTTGGCCAAAGGACTTGG + Intergenic
905809200 1:40899541-40899563 CTTGTCCTGGGCAAGTTATTGGG - Intergenic
909379298 1:74979690-74979712 CTTGTTATGGCTCTGGTACTGGG - Intergenic
918552529 1:185759823-185759845 CATGTCATGGACAATGTAATGGG + Intronic
920403711 1:205693553-205693575 CTTGCAAAGGCCAGGGTACTGGG - Intergenic
923859373 1:237877554-237877576 CTTGTCATGGCCAAGGTACTTGG + Intergenic
1063935543 10:11073938-11073960 CTTGTAATGGCCATAGAACTTGG + Intronic
1064611472 10:17106995-17107017 CTCCTCATTGCCAAGGTACAAGG + Intronic
1065224841 10:23533144-23533166 CTTGCCTCGGCCAAAGTACTGGG + Intergenic
1066159108 10:32709714-32709736 CTGGTCATGGCCTCGGTGCTGGG + Intronic
1068365888 10:56049586-56049608 CTTGTGAGGGCCAAGGTCCTTGG + Intergenic
1068699910 10:60008835-60008857 ATTTTCTTGGCCAAGGGACTAGG - Intergenic
1068775855 10:60867044-60867066 CTTATTATGTCCAAGGTACTTGG + Intergenic
1084045248 11:66564422-66564444 CTGGTCATGGCCCAGGCAGTGGG + Intronic
1086285524 11:85245417-85245439 CATGCCATAGCCAAGGTATTAGG + Intronic
1089701547 11:120247400-120247422 CTTGTCAGGGGCAAGATAATTGG + Intronic
1090128906 11:124118674-124118696 CTTGTCCTCTCCTAGGTACTCGG - Exonic
1090626985 11:128616362-128616384 CCTGTCATGGCTCAGGAACTGGG - Intergenic
1095851626 12:46814780-46814802 CTTGTCTTGGACAAGATACATGG + Intronic
1096188684 12:49600501-49600523 CGTATCATGGCCATGGGACTTGG + Exonic
1101260716 12:103026894-103026916 CTTGACATCTCCAAGGTACTTGG + Intergenic
1102511744 12:113420775-113420797 CTTGTCCTGGACTGGGTACTGGG - Intronic
1105764205 13:23542648-23542670 TTACTCATGGCCAAGTTACTTGG + Intergenic
1106485867 13:30171980-30172002 CTTGTTAGGGCCAAGCTACCTGG - Intergenic
1111256482 13:85676360-85676382 CTTGTAATAGACAAGGTACCAGG + Intergenic
1115216931 14:31023043-31023065 CTTGTCATGGAAAAGACACTAGG - Intronic
1118485834 14:66213767-66213789 CTTGTGAAGGCCAAGGCCCTTGG - Intergenic
1122832927 14:104411220-104411242 CCTGCCTTGGCCAAGGTGCTGGG + Intergenic
1124823922 15:33074682-33074704 CTTGTGATGACCAAGGAACACGG + Intronic
1126967316 15:54069617-54069639 CTTGTCATGGGCCATGTACTTGG + Intronic
1131296237 15:91151682-91151704 CTTGTCATTTCCAAGGAAATGGG - Intronic
1132282967 15:100635898-100635920 TTTGTCATGGAGAAGGTTCTGGG + Intronic
1139771824 16:69283743-69283765 CTGGGCCTGGCCAAGATACTGGG - Intronic
1140296911 16:73717766-73717788 CTTTTCATGGCTAATGAACTGGG - Intergenic
1143520688 17:7442694-7442716 CTTGTCCAGGCCGAGGTACCAGG - Exonic
1144788829 17:17846403-17846425 CTGGCCATGGGCAAGGGACTCGG - Intronic
1148645821 17:49219344-49219366 CTTGTCATTGCCTGGGTTCTGGG - Intronic
1149421636 17:56517273-56517295 ATTATCATGGCCAAGCTCCTGGG - Intergenic
1161975570 19:7606337-7606359 CTGGTCAGGGCCAAGGGACCTGG - Exonic
1164817871 19:31220043-31220065 CTTGTCAAGGCCAAGGTGGATGG + Intergenic
1165153688 19:33775024-33775046 CTGGTCCTGGCCAAGGTGCAGGG - Intergenic
1165206704 19:34194732-34194754 CTTATCATTTCCAAGTTACTGGG + Intronic
1166074414 19:40405394-40405416 ACTGTCATGGCCAACGCACTGGG + Intronic
1167747434 19:51360576-51360598 GTGGCCCTGGCCAAGGTACTTGG - Intronic
925012177 2:494592-494614 CTTGTCTTGGCCACGTTACCCGG - Intergenic
925736242 2:6966613-6966635 GTTGTCATGGAAAAGGAACTTGG - Intronic
928195896 2:29216210-29216232 CTTCTCATGGCCATGGTCGTGGG + Intronic
928799391 2:35068279-35068301 GCAGTCATGGCCAATGTACTGGG - Intergenic
929385958 2:41407128-41407150 CATGTCATGGAAAAGGTCCTAGG + Intergenic
930384562 2:50677692-50677714 ATTGTCATGGCCTACATACTAGG - Intronic
930722829 2:54654173-54654195 TTAGTCATGTCCAAGGTACGTGG - Intronic
932281608 2:70497734-70497756 GCTGACATGGCCAAGGTTCTTGG - Intronic
935436376 2:103038958-103038980 CTAGTGAAGGCCTAGGTACTGGG + Intergenic
940660798 2:156542975-156542997 CCAGGCATGGTCAAGGTACTAGG - Intronic
941715446 2:168758528-168758550 CTTGACATGGCCAAGGGCCATGG + Intronic
945407932 2:209472389-209472411 CTGTTGAAGGCCAAGGTACTTGG + Intronic
945944368 2:215980684-215980706 CTTGGGGAGGCCAAGGTACTCGG + Intronic
946506244 2:220304080-220304102 CATGGCATGGCCATGGTATTGGG + Intergenic
1169423957 20:5481964-5481986 CCTTCCATGGCCAAAGTACTAGG - Intergenic
1171087348 20:22250242-22250264 CTTGTCCTGGCCCAGGCAATGGG - Intergenic
1172962293 20:38807270-38807292 CTACTCGTGGGCAAGGTACTTGG + Intronic
1173825604 20:46045873-46045895 CTTGCCATGGCCAAAGACCTGGG - Exonic
1174024731 20:47564420-47564442 CCTGTCATGTGCAAGTTACTGGG + Intronic
1178218419 21:30626753-30626775 CTGGGCATGGCCCAGCTACTCGG - Intergenic
1179927147 21:44541021-44541043 CCTGCCTTGGCCAAAGTACTGGG + Intronic
1181688555 22:24545407-24545429 CATGGCATGGCCAAGATGCTGGG + Intronic
1183965018 22:41436429-41436451 TTTGACATGGCCCAGGTATTTGG - Exonic
1185005147 22:48271506-48271528 CTTGGCATGGGGAAGGAACTGGG - Intergenic
951940978 3:28078719-28078741 CTTATCATGGGCCAGGTGCTTGG + Intergenic
954218163 3:49135823-49135845 GTTATCACGGTCAAGGTACTTGG + Intergenic
954925611 3:54231760-54231782 CTTGTCAAGGCCAAGGTTATTGG + Intronic
955370341 3:58346037-58346059 CCTGGCATGGCCTAGGCACTTGG + Intronic
955561261 3:60193586-60193608 CTTGTCAAGGCCATGGTTATAGG - Intronic
956228887 3:66990397-66990419 CTTGTTATGGCCAATGAAATGGG + Intergenic
961007911 3:123417201-123417223 CTTGGCATCCCCAAGGTACCAGG + Intronic
964023998 3:152049631-152049653 CTTGTCATGCATTAGGTACTGGG + Intergenic
964246454 3:154659669-154659691 CTTGTCTTGGCCAAAGTAAGTGG + Intergenic
967385185 3:188904153-188904175 CTTGCTGTGGCCCAGGTACTTGG + Intergenic
967806234 3:193716762-193716784 CTTGGCAATGCCAAGGTTCTGGG + Intergenic
971028196 4:22608905-22608927 CTTGGAATGACCAAAGTACTAGG + Intergenic
972011432 4:34188214-34188236 CTTCTCATGGAAAAGGTAATAGG - Intergenic
974262087 4:59539053-59539075 CTTGTCATGGGTAAGTAACTGGG + Intergenic
976750905 4:88450570-88450592 CCTTCCATGGTCAAGGTACTAGG + Intergenic
978330606 4:107609092-107609114 CCTGTCATGGTCAGGGTTCTTGG + Intronic
979714510 4:123820910-123820932 CTAGTCATGAACCAGGTACTGGG + Intergenic
986028931 5:3877353-3877375 CTGGTGATGGCCCAGGGACTTGG - Intergenic
996344376 5:122473853-122473875 CTTGTCTTGGTCAAGTGACTCGG - Intergenic
1000302371 5:159967828-159967850 CTTCTCAAGGCCATGGTCCTTGG + Intronic
1000690482 5:164312949-164312971 CTTGTCATGGCTGAGAAACTTGG + Intergenic
1005129507 6:22489107-22489129 CTTGTCATGGCAAAGGAAACTGG + Intergenic
1006023084 6:31129208-31129230 TCTGTCATGTCCAAGGTTCTGGG + Intronic
1006939013 6:37739132-37739154 CTTTTCATGGGCAAGGAGCTGGG - Intergenic
1011060048 6:83254828-83254850 TTTGTCATGGCCAAGGGAGGTGG - Intronic
1012592511 6:100999731-100999753 CATGTCATAACCTAGGTACTGGG + Intergenic
1016065282 6:139676120-139676142 CTTGTGAAGGCCACGGCACTGGG + Intergenic
1017023710 6:150163024-150163046 CTTGGCATGGCCAAGGGACTAGG + Intronic
1018627536 6:165793871-165793893 CTTATAATGGGCCAGGTACTGGG + Intronic
1018900768 6:168050681-168050703 CTTGCCGTGGCCAAGGCCCTGGG + Intergenic
1020433736 7:8140177-8140199 GTTGTCATAGTCAAGGTAATTGG - Intronic
1020923203 7:14291213-14291235 CTGTTCATGGCCATTGTACTTGG - Intronic
1022049513 7:26651840-26651862 CTTTTAATGGCCAAAGTCCTTGG + Intergenic
1024310726 7:47966581-47966603 CTTGTCAGGACCAAGGGTCTGGG + Intronic
1031212634 7:118850077-118850099 CTTGTTATGGCAAACATACTTGG - Intergenic
1032342812 7:131091564-131091586 CATTTCATGGCCTAAGTACTGGG + Intergenic
1035865001 8:3072511-3072533 CATGTCATGGTCAAAATACTTGG + Intronic
1035890449 8:3337106-3337128 CTTGTCATGCCCAGGGTTCCAGG - Intronic
1035921944 8:3686707-3686729 CGTGGCAAGGCCAAGGGACTTGG - Intronic
1036061569 8:5327784-5327806 CTTATCATGGCCCAGGGACTTGG + Intergenic
1036147702 8:6269947-6269969 CCTGCCATGGGCCAGGTACTGGG + Intergenic
1036556754 8:9866835-9866857 CTTGACCTTGCCAAAGTACTGGG + Intergenic
1038179810 8:25215456-25215478 CTGATGATGGCCAGGGTACTGGG - Intronic
1040306466 8:46214516-46214538 CTTGTCATGGCCAAGATGCAGGG + Intergenic
1043109201 8:76157097-76157119 TTTGTAATGGGCACGGTACTTGG - Intergenic
1043913756 8:85896000-85896022 CTTGCCATGTACAAGGTGCTGGG - Intergenic
1048366154 8:133740390-133740412 CTTCTCATGGCCCAGTTCCTGGG - Intergenic
1049670765 8:143868808-143868830 CTTGTCAGCGCCAACGTATTCGG + Exonic
1050245932 9:3689659-3689681 CTTGTCATGGGTAAGTTCCTTGG - Intergenic
1056252696 9:84766420-84766442 CTTGTCTTATCCAAGGTACTTGG + Intronic
1057529440 9:95831245-95831267 CTTGAAATGACCAAGCTACTGGG + Intergenic
1060938944 9:127532350-127532372 CTTTTCAAGGCCAAGGTAGGTGG + Intronic
1062177886 9:135174409-135174431 GCTGTCATGGCCAATGCACTGGG + Intergenic
1191648612 X:63510769-63510791 CAAGTCATGGCCAAAGTAATAGG + Intergenic
1195769130 X:108330298-108330320 CTGGTCCTGGCCCAGATACTAGG + Intronic
1197158286 X:123294079-123294101 TTTATCATGGACAAAGTACTGGG + Intronic
1200791732 Y:7305240-7305262 CTGGTCATTGCAGAGGTACTTGG - Intergenic
1200892798 Y:8341473-8341495 ACTGTCATGGGTAAGGTACTGGG + Intergenic