ID: 923859427

View in Genome Browser
Species Human (GRCh38)
Location 1:237878155-237878177
Sequence CTGGTAACAAGAATAATGGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923859427_923859432 12 Left 923859427 1:237878155-237878177 CCTACCATTATTCTTGTTACCAG 0: 1
1: 0
2: 0
3: 15
4: 143
Right 923859432 1:237878190-237878212 AGTTCCATGTTGTTGGTTGTTGG 0: 1
1: 0
2: 0
3: 11
4: 198
923859427_923859431 5 Left 923859427 1:237878155-237878177 CCTACCATTATTCTTGTTACCAG 0: 1
1: 0
2: 0
3: 15
4: 143
Right 923859431 1:237878183-237878205 GTAAACAAGTTCCATGTTGTTGG 0: 1
1: 0
2: 0
3: 15
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923859427 Original CRISPR CTGGTAACAAGAATAATGGT AGG (reversed) Exonic
900387038 1:2415403-2415425 CTGCCAACAAGAATAACGCTCGG - Intergenic
902631805 1:17709213-17709235 ATGGTAATAACATTAATGGTGGG + Intergenic
903107001 1:21089878-21089900 CTGGTAATAAGCACAATGGCAGG - Intronic
906036287 1:42752141-42752163 CTGGCAACAAGAATGTTGGCAGG + Intronic
908146576 1:61252292-61252314 CTGGTAAAAACAATAGTGCTAGG - Intronic
910121188 1:83792186-83792208 CTGGAAACAAGAGTAAATGTGGG - Intergenic
911296863 1:96128262-96128284 CTGGTAACAAAGAGACTGGTGGG + Intergenic
916358782 1:163943763-163943785 CTGGTCACAAGTAGGATGGTGGG - Intergenic
918037046 1:180883774-180883796 AAGGTAACAAGAACAATGGCAGG - Intronic
919565845 1:199186369-199186391 CTGGTGCCAGGAACAATGGTAGG - Intergenic
921275997 1:213520612-213520634 CTGATAAAAAGAATAAAGGAAGG - Intergenic
921587210 1:216961946-216961968 CCTGTAACAAGAATCATAGTGGG - Intronic
923350243 1:233097711-233097733 CTGGTAAAAAGTAAGATGGTAGG - Intronic
923859427 1:237878155-237878177 CTGGTAACAAGAATAATGGTAGG - Exonic
924751436 1:246895804-246895826 CTGATAACAAGTAAAATGTTTGG - Intronic
1064669256 10:17692489-17692511 CTGGTAACTGGCAGAATGGTTGG + Intronic
1065574956 10:27108520-27108542 ATGATAATAATAATAATGGTTGG - Intergenic
1065843702 10:29727496-29727518 CTGTAAAGATGAATAATGGTTGG - Intronic
1066359178 10:34713881-34713903 CTGGTAACTATAATATTGGGTGG + Intronic
1067787079 10:49258253-49258275 GAGGGAAGAAGAATAATGGTTGG - Intergenic
1072819282 10:98540134-98540156 CTGGTAACTAAAAGAATGCTAGG + Intronic
1074822969 10:117195256-117195278 CTGGTGACAAGTTTAATAGTTGG + Intergenic
1074938411 10:118210326-118210348 CTGCTATCAAGACTAATGCTGGG + Intergenic
1076456995 10:130607204-130607226 CACGCAACAAGAATAAAGGTGGG + Intergenic
1077075923 11:702138-702160 CTGATAACAAGAGGAAGGGTGGG - Intronic
1078365516 11:10703119-10703141 CTGGTAACTAGAATAGTGTATGG + Intergenic
1081184398 11:40024336-40024358 TTGGTAATAGGAATAATGGGAGG + Intergenic
1087213411 11:95467518-95467540 CTGGTAAAAAGAACACTGGTGGG - Intergenic
1089917365 11:122171233-122171255 CTGGTGCCAAGCACAATGGTTGG - Intergenic
1090550188 11:127810893-127810915 ATGATGACAAGAATAAAGGTGGG + Intergenic
1094824494 12:34258917-34258939 CTGGTAAGAAGACAAATGCTGGG + Intergenic
1095241379 12:39863134-39863156 TTTGTAATAAGAATAAAGGTAGG + Intronic
1095335189 12:41015995-41016017 CTGGTAAGAGGAATAAAAGTAGG - Intronic
1098530325 12:71534448-71534470 ATGGAAATAAGGATAATGGTAGG - Intronic
1102826530 12:115951796-115951818 ATGGAAGCTAGAATAATGGTGGG - Intergenic
1104257893 12:127155804-127155826 GTGGTATCAAGAATAATGTGGGG - Intergenic
1106423899 13:29607414-29607436 ATGGTAACAACAATAATGATAGG - Intergenic
1111730855 13:92074757-92074779 ATGGTAACCAGAATAATAGGAGG + Intronic
1112993578 13:105544639-105544661 CCGGGAACAAGAATAATGCCTGG + Intergenic
1113391004 13:109897016-109897038 ATGGTAACATGTATATTGGTAGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114950908 14:27752353-27752375 GTGGTCACATAAATAATGGTAGG + Intergenic
1115790119 14:36868955-36868977 CTGGGAGCTAGAATCATGGTAGG - Intronic
1116647939 14:47553273-47553295 CTGGCAACAAGAAAAGTGTTCGG + Intronic
1116860315 14:49990211-49990233 AGGGTAACAAGAACTATGGTTGG - Intronic
1120174568 14:81279392-81279414 CTAGTAATAAGAAAAATGGCCGG + Intronic
1121656836 14:95603333-95603355 ATGGCAACAAGAACAAAGGTGGG + Intergenic
1122600836 14:102920916-102920938 ATGGTAAGATGAATAGTGGTTGG - Intergenic
1123669548 15:22641346-22641368 ATGGTAACCAGAATAATAGGAGG + Intergenic
1124186751 15:27536976-27536998 ACGGTGATAAGAATAATGGTTGG - Exonic
1124525524 15:30447786-30447808 ATGGTAACCAGAATAATAGGAGG + Intergenic
1124773130 15:32559898-32559920 ATGGTAACCAGAATAATAGGAGG - Intergenic
1127399091 15:58567741-58567763 CTGGTAACAGGAAAAATTGCAGG + Intronic
1127567656 15:60208597-60208619 TTGGTAACAAGAGTTGTGGTAGG - Intergenic
1128911694 15:71521253-71521275 CTGCAAACAAGAAAAATGGTGGG + Intronic
1131086875 15:89583357-89583379 CTGGTAACAAGCATCATTCTGGG - Intronic
1133435574 16:5776503-5776525 ATGGTAATAATAATAAGGGTTGG + Intergenic
1133658486 16:7890758-7890780 CTGGTAACAATATTAAGGCTGGG - Intergenic
1133699527 16:8295990-8296012 CTATTAACAAGAATGATGGGAGG - Intergenic
1137651868 16:50127439-50127461 CTAGTAACAAGAAAGATGATGGG + Intergenic
1139660911 16:68420237-68420259 TTAGTAATAAGAATAATGGCCGG - Intronic
1146471314 17:33127174-33127196 CTAGCAACAAGAGTAATGGTAGG - Intronic
1146589291 17:34114635-34114657 CTGGGAAAAAGAATGATGCTAGG - Intronic
1148607489 17:48941178-48941200 ATGGTAAACAGCATAATGGTAGG - Intronic
1149329620 17:55567623-55567645 CTGGTAAGAGCAATATTGGTTGG - Intergenic
1159539425 18:69756207-69756229 TTGGTAACAATAATAACGGCAGG - Intronic
1162579902 19:11522772-11522794 CTAGTAAAAAGAAAAAAGGTCGG + Intronic
1164204874 19:23049900-23049922 GAGGTAACAATCATAATGGTTGG + Intergenic
1164585302 19:29466588-29466610 CTGGTAGTAAGAATACTGATGGG + Intergenic
1164813932 19:31179709-31179731 GTGGTAACAATGATGATGGTAGG + Intergenic
1164863348 19:31581317-31581339 CTGGTCACAATATTAATTGTTGG + Intergenic
1164965188 19:32477224-32477246 CTGTTCACCAGAATAACGGTGGG - Intronic
1165183058 19:33989449-33989471 CCTGGAACAAGGATAATGGTGGG - Intergenic
1168301966 19:55410119-55410141 CTTGTAACAACCATAATGGGTGG + Intergenic
926590749 2:14737826-14737848 CTGCTAACAAGAAAAATAGGGGG + Intergenic
926824504 2:16890698-16890720 GTGGTAAAAAAAATAATGGGTGG - Intergenic
927391164 2:22597072-22597094 CTGGAAACAAGAATAACATTTGG + Intergenic
928393892 2:30929616-30929638 CTGGGAACAGGAATGATAGTCGG - Intronic
934911182 2:98255794-98255816 CCCGTAAGAAGAAAAATGGTGGG + Intronic
939844925 2:147231242-147231264 CTGTAAACAAGACTAGTGGTTGG - Intergenic
940462542 2:153985135-153985157 CTGATAATAAAAATAATAGTTGG - Intronic
943800178 2:192047388-192047410 ATGGTAATAAAAGTAATGGTAGG - Intronic
944332588 2:198489016-198489038 ATGGAAATAAGAATAATGATAGG - Intronic
1169592217 20:7157448-7157470 CTGGTGATAGGAATAATGGGAGG + Intergenic
1169855615 20:10099351-10099373 CAGATAAAAAGAATAAAGGTCGG + Intergenic
1170311872 20:15001080-15001102 ATGATCTCAAGAATAATGGTGGG + Intronic
1170491085 20:16875641-16875663 CAGCTAAGAAGAATAATGGGGGG - Intergenic
1171539397 20:25934480-25934502 ATAGAAACAAGAATAATGGCTGG - Intergenic
1171801645 20:29625802-29625824 ATAGAAACAAGAATAATGGCTGG + Intergenic
1171842325 20:30229692-30229714 ATAGAAACAAGAATAATGGCTGG - Intergenic
1174134506 20:48369924-48369946 CTAGTAACAATAAAAAAGGTGGG - Intergenic
1174567657 20:51478357-51478379 TTGGTATCAAGAAGAAAGGTAGG + Intronic
1177413595 21:20765258-20765280 CTAGTCACTAGAATAATGCTAGG + Intergenic
1178047164 21:28708648-28708670 CTATTAACAAAAATAATGCTAGG + Intergenic
1181339608 22:22167065-22167087 CTGGCAATGAGAATACTGGTTGG + Intergenic
1181583660 22:23841588-23841610 CTGGTAACCAGGATAATGGCAGG + Intergenic
1182660623 22:31922498-31922520 GTGGTAATAAAAATAATGATTGG - Intergenic
1182986037 22:34717749-34717771 CTGCTAACTAGAATAATAGAGGG + Intergenic
1183768812 22:39905368-39905390 CAGGTAATAATAATAATAGTAGG + Intronic
952485015 3:33800935-33800957 CTGGTAAAAAGAATAAAGGAAGG - Intronic
953172281 3:40518137-40518159 CAGGTAACAGCAATAATGGTAGG - Exonic
955515508 3:59722633-59722655 CAGGTAACATGGATACTGGTGGG - Intergenic
955774567 3:62419538-62419560 CTGCTCACAAGGATAATGGGTGG - Intronic
958028995 3:88084308-88084330 CTGGGAACAAGAAAAATGTGAGG + Intronic
958436520 3:94103349-94103371 TTGTTAACAAGAATAAAGTTAGG - Intronic
958675883 3:97267976-97267998 CTTATAACAAGAACAAAGGTAGG + Intronic
959105078 3:102056501-102056523 CTAGAAAGAAGAATGATGGTTGG - Intergenic
963428867 3:145170028-145170050 GTGGTAACAAAATGAATGGTTGG - Intergenic
964026871 3:152084802-152084824 CTAGTAACCAGAAGAAAGGTTGG - Intergenic
965676683 3:171205077-171205099 CTGTTAATAAGAACAATGGTAGG - Intronic
966656591 3:182365056-182365078 CTGGAAACAAGAATCAGGCTTGG + Intergenic
966864242 3:184248188-184248210 CTGGTAACCAGCATAATGCTAGG + Intronic
968823510 4:2875347-2875369 CTGGTTAAAAGAACAATGGCAGG - Intronic
970726432 4:19050850-19050872 CTGGAGACAAGAATACTGATTGG - Intergenic
971226535 4:24758681-24758703 CTGGCAAAAAGAAAAAGGGTGGG - Intergenic
974104647 4:57456039-57456061 CTGATAACAAGGATAATATTAGG + Intergenic
974241747 4:59258418-59258440 CTAGAAAAAAGAATAAAGGTGGG + Intergenic
975689826 4:76951546-76951568 CTGCTAATAAGTATAATGGGGGG - Intronic
975966864 4:79984429-79984451 CTGTTAACCAGAATCATGTTAGG - Intronic
976858415 4:89631498-89631520 AATGTAATAAGAATAATGGTGGG + Intergenic
977676237 4:99750877-99750899 ATTGTATCAAGAATAATGGCAGG - Intergenic
979146847 4:117255946-117255968 GTGGTATCAAGAATAATGCAGGG - Intergenic
981409349 4:144410414-144410436 CTGGTAGCATGAATACTGCTAGG + Intergenic
981560143 4:146039266-146039288 CTGCTAACAATAATCATGGGTGG - Intergenic
982993261 4:162306806-162306828 TTGGTAACAACAATGAAGGTAGG - Intergenic
983278304 4:165646328-165646350 CTGGCAACAACAATAATAATAGG - Intergenic
984153284 4:176161404-176161426 TTGGTATCTAGAATAATGTTTGG + Intronic
985934633 5:3087408-3087430 GTGATAACAATAATAATTGTTGG + Intergenic
986350339 5:6872203-6872225 GTGGTAAATAAAATAATGGTAGG + Intergenic
993572391 5:89557606-89557628 CTGGTAAAAAAGATGATGGTGGG + Intergenic
995006999 5:107211100-107211122 TTGGTAACAAGAATGATGGATGG - Intergenic
996314457 5:122146148-122146170 CTGCCAACAGGAATAATGGGAGG - Intronic
996950246 5:129117831-129117853 CAGGGAATAAGAATAAGGGTAGG - Intergenic
998907308 5:146919843-146919865 CTTGTAATAAGAAAAATAGTTGG + Intronic
999086772 5:148899053-148899075 GTGGTATCAATAATAATGTTAGG - Intergenic
999939625 5:156527794-156527816 CTGGTGACAGGAAGATTGGTTGG - Intronic
1001663031 5:173410886-173410908 TTGGTAACAAAATTAATGTTTGG + Intergenic
1003425960 6:5998586-5998608 CTAGTAACATGAAAAATGATGGG - Exonic
1004559618 6:16735291-16735313 CTTCTAACAATAATAATGGCTGG - Intronic
1005387643 6:25301299-25301321 GTGGTAACAAGAACAATAGGAGG + Intronic
1005422983 6:25672258-25672280 CTGGTGACTAGAATAATGCTTGG - Intronic
1008057752 6:46962815-46962837 CTGCTAACTAGAAGAATGGTGGG - Intergenic
1014460591 6:121690293-121690315 CGGGTAACAATGATAATGGCTGG - Intergenic
1025290779 7:57720405-57720427 ATAGAAACAAGAATAATGGCTGG - Intergenic
1026855442 7:73750757-73750779 TTGGTAACAAGAACAGTGCTTGG - Intergenic
1028746395 7:94331903-94331925 CTGTTTAGAAGAATAATGGTGGG - Intergenic
1033255835 7:139800506-139800528 CAGGTAATAAGAATAGTGGCGGG - Intronic
1043610302 8:82054681-82054703 ATGGTAAAGAGATTAATGGTGGG - Intergenic
1046151186 8:110228579-110228601 CTAGAAAGAAAAATAATGGTTGG - Intergenic
1046947691 8:119989353-119989375 CTGGAAACAGGAATAAATGTGGG + Intronic
1047654445 8:126961532-126961554 ATGGCAACAAGAATATTGGAAGG - Intergenic
1052466268 9:28833805-28833827 CTGATAAGAAGGATATTGGTAGG + Intergenic
1057706240 9:97396945-97396967 CTGGTAAGAAAAAGAAGGGTTGG - Intergenic
1187854239 X:23621506-23621528 CTGGTAGCATGACAAATGGTTGG - Intergenic
1189683636 X:43541688-43541710 CTGGTTAAGAGAAAAATGGTAGG + Intergenic
1194792148 X:98163722-98163744 CTGGTAACAATAAAAATGCTAGG + Intergenic
1197645232 X:129010098-129010120 CTGTAAACAAGAATAAAGGTGGG - Intergenic
1201773144 Y:17637790-17637812 CTGGTAAGAAGATAAATGCTGGG + Intergenic
1201828411 Y:18268196-18268218 CTGGTAAGAAGATAAATGCTGGG - Intergenic