ID: 923859457

View in Genome Browser
Species Human (GRCh38)
Location 1:237878443-237878465
Sequence GAGAGAAGTTGGAAGTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923859457_923859459 9 Left 923859457 1:237878443-237878465 CCAGCAGACTTCCAACTTCTCTC 0: 1
1: 0
2: 2
3: 27
4: 235
Right 923859459 1:237878475-237878497 TATATACTATAGAATTTAATTGG 0: 1
1: 1
2: 4
3: 32
4: 445

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923859457 Original CRISPR GAGAGAAGTTGGAAGTCTGC TGG (reversed) Intronic
901182638 1:7352163-7352185 GAGAGAAGGAGGAAGTGGGCGGG + Intronic
904330357 1:29754481-29754503 AAGAGAAATTGGCAGCCTGCTGG - Intergenic
904579528 1:31531087-31531109 GAGTGAAGTTGGAAATGTCCAGG + Intergenic
904753835 1:32757234-32757256 GAGAGAGGTCTGGAGTCTGCAGG + Intronic
904859131 1:33521571-33521593 GAGAGCAGGTGGGAGGCTGCTGG + Intronic
906941847 1:50262417-50262439 TAGAGAAGTTGTAAACCTGCTGG + Intergenic
907834050 1:58092561-58092583 GAAAGGACCTGGAAGTCTGCTGG - Intronic
912166969 1:107053529-107053551 GAGAAGAGTTGGAGTTCTGCTGG - Intergenic
913168126 1:116208317-116208339 GAGAGAAGCCGGAAGACAGCGGG - Intergenic
914957415 1:152175364-152175386 GGGAGAAGTTAGAAGTCTTCTGG + Intergenic
916187330 1:162145891-162145913 GAGAGAGTTTGGAAGAATGCAGG + Intronic
916982519 1:170154105-170154127 GGCAGAAGTTGTAAGTCTGTTGG + Intronic
918390969 1:184061399-184061421 CAGAGGAGTTGGCAGTTTGCTGG + Intronic
918800649 1:188966688-188966710 GACAGAGGTTGGAAGTATACAGG - Intergenic
919614182 1:199784971-199784993 GAGAGAAGGTGGGAGGCTGATGG - Intergenic
922450208 1:225731288-225731310 GAGAGAAGGTGGTAGTCTCCAGG + Intergenic
923163361 1:231337227-231337249 TTGAGAAGGTGGAAGGCTGCAGG - Exonic
923163727 1:231339505-231339527 TTGAGAAGGTGGAAGGCTGCAGG - Intronic
923265010 1:232306021-232306043 GAAACAAGTTGGAAGGGTGCTGG - Intergenic
923859457 1:237878443-237878465 GAGAGAAGTTGGAAGTCTGCTGG - Intronic
924040768 1:239981713-239981735 GAGAGGAGATGGAAGTCTGAGGG - Intergenic
1063360386 10:5450245-5450267 GAAAGAATTTGGAAATCTGAAGG - Intronic
1065546477 10:26826784-26826806 AAGAAAAGTTGGAAGCCAGCGGG - Intronic
1067009680 10:42698815-42698837 GAAAGAACTTGCAAATCTGCTGG + Intergenic
1067203868 10:44197444-44197466 GATAGAATTTGGAAGTCGGAAGG + Intergenic
1067313053 10:45133400-45133422 GAGTGAATTTGGAGGTCAGCTGG + Intergenic
1069115616 10:64502321-64502343 GACAGAATTTGGAATTCTGTTGG + Intergenic
1069334326 10:67329898-67329920 GTGAGAAGTTGGAAGACGCCTGG - Intronic
1072706997 10:97687717-97687739 GAGAGGAGGGGGCAGTCTGCTGG + Intergenic
1073117801 10:101101870-101101892 GAGAGAAGTTAGTAGTCTTGTGG + Intronic
1073140710 10:101245614-101245636 GAAAGCAGGTGGAAGTCTGGAGG + Intergenic
1075684260 10:124353129-124353151 GAGAGGAGAAGGAGGTCTGCAGG - Intergenic
1075725280 10:124607787-124607809 GAGAAAAGTTGGAAATCAGATGG + Intronic
1075791663 10:125088772-125088794 GTGAGAAGTGGGAAGTATGAAGG - Intronic
1075984118 10:126768480-126768502 GATAGAAGTTGGAAGTTAGTAGG - Intergenic
1076166316 10:128285317-128285339 GGGAGAGGTTGGAAGCCTGAGGG + Intergenic
1076490824 10:130860172-130860194 AAGGGAAGGTGGGAGTCTGCAGG - Intergenic
1078051134 11:7965682-7965704 GAGGGATGTGGGAAGTCTCCTGG - Intergenic
1078070001 11:8102176-8102198 GAGAGAAGTTGGGAGGGTGGTGG + Exonic
1078079059 11:8190952-8190974 GAGAGAGGGTGGAGCTCTGCAGG - Intergenic
1078753789 11:14189601-14189623 GAAAGAAGTTGGAAGTGGGAAGG - Intronic
1079350480 11:19687621-19687643 CAGGGAAATTGTAAGTCTGCAGG + Intronic
1082053455 11:47792887-47792909 CAGAGAAGTTCGAACTCTCCGGG - Exonic
1082682056 11:56186536-56186558 AAGACAAGTTGAGAGTCTGCTGG - Intergenic
1083899846 11:65638298-65638320 GAGGGAAGTTGGGAGGGTGCTGG - Intronic
1084532011 11:69732886-69732908 GAGAGAAGGTGGAAGATTACAGG + Intergenic
1084907058 11:72356487-72356509 GTCAGAAGTTGGCAGCCTGCAGG + Intronic
1085065165 11:73488623-73488645 GAGAGAAGTTAAGAGTCTGTGGG - Intronic
1085157151 11:74306201-74306223 TAGAAAGGTTGGAAGTGTGCTGG - Intronic
1087821014 11:102712485-102712507 GATAGAAGTCCGAATTCTGCAGG + Exonic
1088554096 11:111044017-111044039 AAGAGAAGGAGGAAGTCTGATGG - Intergenic
1089379346 11:118016367-118016389 GAGAGAGGTTGGAAACCTGCAGG + Intergenic
1090682259 11:129073825-129073847 GAAAGAAGCTGGGAGTTTGCGGG + Intronic
1091794072 12:3287387-3287409 GAGAGCAGTTGGAGGTTTGGAGG + Intergenic
1093980471 12:25469924-25469946 AAGAGAAATTGGAAGCCAGCGGG - Intronic
1099198327 12:79646197-79646219 GAGAAATGATGAAAGTCTGCAGG + Intronic
1099856414 12:88173416-88173438 GAGAGAAGTCAGAATTCTGTGGG - Intronic
1101143742 12:101821827-101821849 GAGAGAAGTTGTCACTCCGCTGG + Intronic
1101194449 12:102368640-102368662 GAGGGAAGTTGTAAGTTTGTGGG - Intergenic
1102184346 12:110936059-110936081 GAGAGAAGCTGGAAGTTTCCAGG - Intergenic
1104290018 12:127457927-127457949 GAGAGAAGTTGGAAGTGATCGGG + Intergenic
1107328579 13:39272177-39272199 GTGAAAAGATGGAAGGCTGCTGG + Intergenic
1107942165 13:45384340-45384362 GAAGGAATTTGTAAGTCTGCCGG - Intergenic
1107978545 13:45713448-45713470 GGGAGAAGTAGGGAGACTGCAGG - Exonic
1110506277 13:76290847-76290869 GACAGAAGTAAGAACTCTGCAGG + Intergenic
1113545314 13:111144463-111144485 GAGCTAACTTGGAAGTCTCCAGG - Intronic
1116382450 14:44287848-44287870 TAGAGAAATTGGAAGGCTTCGGG + Intergenic
1117076859 14:52113941-52113963 GAGAGAATTTGGAGGGCTCCGGG - Intergenic
1117169768 14:53081959-53081981 GAGAGAAGTTGGATATGTTCTGG + Intronic
1117512162 14:56463461-56463483 GAGAGCAGTGGGAATTCTGTAGG + Intergenic
1118677529 14:68203848-68203870 AAGAAAAGTTGGAAGTTAGCAGG - Intronic
1119256098 14:73198721-73198743 GAGAGAAGTTGTAAGCTTGAAGG + Intronic
1120489685 14:85161512-85161534 GAGAGAAGGTGTAAGGCTGAAGG - Intergenic
1120739534 14:88092228-88092250 TAGAGGAGTTGGAAGTTTGCTGG + Intergenic
1121547953 14:94776300-94776322 GAGATAAGTTGGGAGACTGAGGG + Intergenic
1121653180 14:95574892-95574914 GAGATAAGGTTGAAGTTTGCAGG + Intergenic
1124001542 15:25764547-25764569 GAGTGAAGGTGGCTGTCTGCAGG + Intronic
1124663076 15:31567074-31567096 GGCAGAAGTTGGAAGTCTGGAGG + Intronic
1125303901 15:38288488-38288510 GAGAGAAGGTGGATGGATGCTGG + Intronic
1128740163 15:70078317-70078339 GAGAGAACTTGTTACTCTGCCGG - Intronic
1131395063 15:92079450-92079472 GTGAGAAGCTGGCCGTCTGCTGG - Intronic
1131696148 15:94880242-94880264 GAGGGAAGCCGGAAGTCTGATGG + Intergenic
1131904838 15:97132048-97132070 GTGAGAAGTTTTCAGTCTGCAGG - Intergenic
1132500315 16:281999-282021 AGGAGAAACTGGAAGTCTGCAGG - Intronic
1133200636 16:4202295-4202317 TAAAGAAGTTGGAGGTCGGCTGG + Intronic
1133330527 16:4970458-4970480 CAGAGACGTTGGAGGTCTGGAGG + Intronic
1135931047 16:26737041-26737063 GAGAGAAGTTAGAAGTTTGAGGG - Intergenic
1138965595 16:62080405-62080427 GAGGGATGTTGCATGTCTGCGGG + Intergenic
1146624293 17:34424169-34424191 GAGAGAAGCGGGCAGGCTGCAGG - Intergenic
1148111747 17:45148472-45148494 GACAGCAGTTGGAAGTTGGCAGG + Intergenic
1149658392 17:58322272-58322294 GAGGGAAGCTGGCAGGCTGCTGG - Intronic
1151809089 17:76425844-76425866 GAGACAGGATGGAATTCTGCAGG - Intronic
1152122649 17:78428224-78428246 TAGGGAAGCTGGAAGACTGCAGG + Intronic
1152211882 17:79006838-79006860 GAGAGAAGGTGGCAGTAAGCAGG - Intronic
1153799831 18:8659337-8659359 CAGCGAACATGGAAGTCTGCTGG - Intergenic
1157789515 18:50519095-50519117 GAGAGAAATTGGAAGTTTTTTGG - Intergenic
1157867348 18:51197737-51197759 GAAAGGAGTTGGAAGGCTGCGGG - Intronic
1158729275 18:60004302-60004324 GAGAGAAGCTGGATACCTGCTGG + Intergenic
1159970708 18:74648515-74648537 GAGAGAAGTGGAAAGCCTGGTGG + Intronic
1160383907 18:78482435-78482457 CAGAGAAGTGGGGACTCTGCAGG + Intergenic
1160738427 19:675137-675159 GAGAGCGGTTGGGTGTCTGCTGG - Intergenic
1161107853 19:2453475-2453497 GAGCAGAGTTGGAAGCCTGCTGG - Intronic
1164550347 19:29205936-29205958 GACAGAAGTAGGAAGTTTGCAGG - Exonic
1164557297 19:29263442-29263464 GAGTGAAGTGTGAAGTCAGCTGG - Intergenic
1166533320 19:43555376-43555398 GAGAGAGTTTGCAAGGCTGCAGG + Intronic
1167202080 19:48072877-48072899 GTGAGAGGTTGGATGTCTGGGGG + Intronic
925210458 2:2041381-2041403 GAGAGAAGTTGGAACCCTGCTGG + Intronic
925278962 2:2669733-2669755 GAGAAAAGTTAGAAGTCAGATGG + Intergenic
925658282 2:6173908-6173930 GAGAGAAGTGAGGAGACTGCAGG + Intergenic
926165528 2:10520622-10520644 GTGAGAAGGTGGCCGTCTGCAGG - Intergenic
926628538 2:15116371-15116393 GTGAGAAGGTGGCTGTCTGCAGG - Intergenic
927063964 2:19450971-19450993 TAGAGAAGTTGGCAGTTTTCTGG - Intergenic
927250105 2:20989425-20989447 TAGAGAAGGGGGAGGTCTGCAGG + Intergenic
927256894 2:21047536-21047558 GAGAGAAGCCAGAAGTCAGCAGG + Intergenic
928953327 2:36834682-36834704 GAGATATGTGGGAAGTCTGTTGG + Intergenic
929243461 2:39676504-39676526 GAGACCGGTGGGAAGTCTGCAGG - Intronic
931157591 2:59653079-59653101 GAGAGGAGTTGGAGGTCAGAAGG - Intergenic
933610984 2:84435068-84435090 GAGGGAAGCTGGGACTCTGCTGG - Intronic
936497324 2:113033797-113033819 GAGAGAACTTGGAGGTCTTGTGG + Intronic
936956128 2:118024115-118024137 AAGAGAAGTTGCAAGGCTGGGGG + Intergenic
939375367 2:141358540-141358562 GAGAGAAGTAGGAAGATTGGAGG - Intronic
939565248 2:143779489-143779511 GAGAAAAGTTTAAAGTCTTCGGG + Intergenic
942542780 2:177031863-177031885 GAGAGATGTTAGAGGTTTGCAGG + Intergenic
942745420 2:179226357-179226379 GGCAGAAGTTGGAGTTCTGCCGG - Intronic
942863848 2:180648693-180648715 GAGGGAAATTGGAAGACTGGGGG - Intergenic
943473656 2:188327934-188327956 GGGAGAAGTAGGAAGTTTCCTGG - Intronic
945522198 2:210842893-210842915 GAGACATGTTAGAAGCCTGCAGG + Intergenic
948572018 2:238923613-238923635 TTGTGAAGTTGGGAGTCTGCAGG - Intergenic
1169388464 20:5170432-5170454 GGGAGGAGCTGGAAGACTGCAGG + Intronic
1170153955 20:13252856-13252878 GAGAGAAGTGGGAAGACAGAAGG - Intronic
1173597515 20:44268731-44268753 GAGAGAACTGGGAACTCTTCAGG + Intronic
1177022857 21:15884889-15884911 GAGAGAAGGTGGTGGTCTGCAGG - Intergenic
1177182988 21:17763565-17763587 GAGATGAGCTGGAAGTCTGGTGG + Intergenic
1177641834 21:23853833-23853855 GAGAGCAATTTGAAGTCAGCAGG + Intergenic
1180786495 22:18550629-18550651 GAGAGAGGATGGAAGTCAGGTGG + Intergenic
1181131776 22:20736352-20736374 GAGAGAGGATGGAAGTCAGGTGG + Intronic
1181243415 22:21490182-21490204 GAGAGAGGATGGAAGTCAGGTGG + Intergenic
1183367980 22:37417304-37417326 GAGAGAGGCTGGAAGTGAGCCGG - Intronic
1183489743 22:38109992-38110014 GGGTGAAGTAGGAAGTCTGAGGG + Intronic
1184388073 22:44187571-44187593 GAGAGAAGCAGGGAGTCTGCAGG + Intronic
949341208 3:3032960-3032982 GAGAGAAGATGGTAGTTTCCTGG - Intronic
949368382 3:3307748-3307770 GAGAGAAGGGGGAAGTTTCCAGG + Intergenic
950915290 3:16638356-16638378 GAGAGTAGTGGGAAAACTGCAGG - Intronic
952333530 3:32385881-32385903 GAGAGAAGGTGGAAGCCAGGAGG - Intergenic
955671547 3:61408135-61408157 GAGAGAAGGTAGCTGTCTGCAGG + Intergenic
956582418 3:70829212-70829234 GAGAGAGGTTGGAAGTTTGCGGG - Intergenic
956891587 3:73619546-73619568 GAGAGAAGTGGAAATTTTGCAGG + Intronic
957414874 3:79888889-79888911 GATAGAAGTTTGAAGTATCCTGG + Intergenic
959653134 3:108771345-108771367 GAAAGATGATGGAAGTCTGGAGG + Intergenic
960425741 3:117505847-117505869 GAGAGAAGTTGCCAGACTCCAGG - Intergenic
960482814 3:118213970-118213992 GTGATAAGCTGGAAGTCAGCAGG + Intergenic
960672434 3:120166351-120166373 GAGAGATCTGGGAAGCCTGCGGG + Exonic
961317816 3:126052483-126052505 GAGAGCAGGAGGAAGGCTGCTGG - Intronic
962055650 3:131868703-131868725 GAGAGAAGTAGGAAGTGTGTTGG - Intronic
962681371 3:137803431-137803453 GAGAGAAGCTGTATATCTGCTGG + Intergenic
963531521 3:146477412-146477434 GAGAGAATTTCCTAGTCTGCTGG - Intronic
967574827 3:191077344-191077366 GAGAGAAATTAGAAGACTGCTGG - Intergenic
967662807 3:192133749-192133771 GAGACAAGTTGTGTGTCTGCTGG + Intergenic
968066180 3:195761055-195761077 GGGTGAAGTTGGAAGGCAGCTGG + Exonic
968938075 4:3624051-3624073 GAGGGGAGTGGGAAGGCTGCGGG - Intergenic
971119365 4:23687113-23687135 GAGAATGGTTGGAAGGCTGCAGG + Intergenic
974088864 4:57289653-57289675 GAGAGAAGATGGCCATCTGCAGG + Intergenic
974924522 4:68280854-68280876 GAGATAAGTTGGAATTTTCCTGG - Intergenic
975740969 4:77428539-77428561 TAGACAAGTTTGAAGTCTGTAGG - Intronic
979932887 4:126654385-126654407 GAGAGACCTTAGAATTCTGCAGG + Intergenic
980639691 4:135561084-135561106 CAAAGAAGTTGGAAGTCTGTAGG + Intergenic
980739517 4:136931133-136931155 GAGAGAAGATGGCTATCTGCAGG - Intergenic
983955449 4:173692466-173692488 ATGAGAAGATGGCAGTCTGCAGG + Intergenic
984617392 4:181914157-181914179 GGGAGAACTTTGAAGTCTTCAGG - Intergenic
985126968 4:186704146-186704168 GAGAGAAGCTGGAAATTTGTAGG - Intronic
986400825 5:7378099-7378121 GATAGAAGTTTGAAGTTTGAAGG - Intergenic
986434514 5:7715035-7715057 GAGAGATGCTGGAAGTCAGAGGG + Intronic
989296885 5:39838811-39838833 GACAGAGGTTGGAAGTTTGGAGG + Intergenic
990759359 5:59111287-59111309 GAAACAAGTTGAAAATCTGCAGG - Intronic
997283877 5:132664819-132664841 GAGAGGAGGTGGGGGTCTGCAGG + Intergenic
997584290 5:135035269-135035291 GAGAGAAGCTGGAAGACTGAGGG - Intronic
999727347 5:154447162-154447184 GAGAGAAGTTGGAAAAGAGCCGG - Intronic
1000406014 5:160889203-160889225 GAGGAATGTTGGAAGGCTGCGGG - Intergenic
1001430791 5:171660418-171660440 GAGAAAACTGGGAAGTCTGATGG + Intergenic
1001865903 5:175105253-175105275 GGGTCAAGTGGGAAGTCTGCAGG + Intergenic
1003882215 6:10489161-10489183 GGGAGAAGATGGCCGTCTGCAGG - Intergenic
1004252596 6:14034410-14034432 GAGACAAGTGGGAAGTCATCTGG + Intergenic
1005591690 6:27335417-27335439 AAGAGAAGTGGGAAGTTGGCCGG + Intergenic
1006189473 6:32198793-32198815 GAGAGGGGTGGGAAGCCTGCTGG - Intronic
1007398878 6:41592382-41592404 GAGAGAAGCTGGGAGGCTGTTGG + Intronic
1007715792 6:43855381-43855403 TAGAGAAGTGGGGAGTGTGCTGG + Intergenic
1007776006 6:44224728-44224750 GAGAGGTGTTGGGAGTCTGGAGG + Intronic
1007881274 6:45170034-45170056 GAGAGAAGTGGGAAGTATGAAGG - Intronic
1010638302 6:78287647-78287669 GAGAAAAGGTGGAAACCTGCTGG - Intergenic
1010660314 6:78562830-78562852 GAGAGAAATTGAAAGGATGCAGG - Intergenic
1011137766 6:84118142-84118164 GGGAGAAATTAGAACTCTGCAGG + Intergenic
1014586500 6:123203776-123203798 GAGAAAAGTTGTAATTCTGAAGG - Intergenic
1016645968 6:146408680-146408702 TAGAGGAGCTGTAAGTCTGCTGG + Intronic
1016751661 6:147637012-147637034 GGGAGAAGTGACAAGTCTGCAGG + Intronic
1018561919 6:165108835-165108857 GAGAGAAGAAGGAAATATGCTGG + Intergenic
1021632425 7:22660279-22660301 GAAAGAAGTAGCAAGTATGCTGG + Intergenic
1021873524 7:25027227-25027249 CAGAGAAGATAGATGTCTGCTGG + Intergenic
1022532112 7:31073646-31073668 GAGAGGAGGTGGGAGCCTGCTGG + Intronic
1022844079 7:34192398-34192420 GAGAGAAGGAGGAAGTTTGAAGG - Intergenic
1022948660 7:35314997-35315019 GAGAGGAGGTGGAAGTCAGATGG - Intergenic
1024374424 7:48620991-48621013 GAGAGGAGCTGCAACTCTGCAGG + Intronic
1026132506 7:67631970-67631992 TAAAGAAGCTGGCAGTCTGCAGG - Intergenic
1026988058 7:74567353-74567375 GAGAGAGGTGGAAAGTCCGCAGG + Intronic
1028186470 7:87791666-87791688 GACAGAATTTGGAAGCCTGATGG + Intronic
1029418821 7:100461375-100461397 GGCTGAAGTGGGAAGTCTGCTGG - Intronic
1029555039 7:101262954-101262976 GGGAGAAGGTGGACATCTGCAGG + Intergenic
1030511547 7:110488821-110488843 TAGGGAAATTGGAAGTCCGCTGG - Intergenic
1032296344 7:130642422-130642444 GATAGAAGTCAGAAGTCTACTGG - Intronic
1032320137 7:130878693-130878715 GGGAGAAGTTGGATGTAGGCTGG - Intergenic
1034752480 7:153583776-153583798 TTGAGAAGTCAGAAGTCTGCAGG + Intergenic
1035892606 8:3362010-3362032 GTGAGAAGATGGAATTCTGAAGG - Intronic
1035992348 8:4506433-4506455 GAGGGGAGTGGGAAGTTTGCTGG - Intronic
1036648540 8:10627010-10627032 GGGAGAAGTTGGAACATTGCTGG + Intronic
1037572567 8:20171108-20171130 GAGAGACTTTGGAAGGCTGTAGG + Exonic
1037648428 8:20815115-20815137 GAGGCTAGTTGGAAGCCTGCGGG - Intergenic
1038019582 8:23541598-23541620 GAGAGAGGTTTGCAGCCTGCAGG + Intronic
1038317361 8:26498437-26498459 GAGGGAAGTAGGAAGTGAGCTGG - Intronic
1038539892 8:28383721-28383743 CAGAGAAGTGGGGAGGCTGCTGG - Intronic
1038643044 8:29342589-29342611 GAGAGAAGATGGAGGTCTGGAGG - Intronic
1040295933 8:46149090-46149112 GAGAGAAGCGGCAAGACTGCAGG - Intergenic
1040301433 8:46189993-46190015 GAGAGAAGGCGCAAGACTGCAGG + Intergenic
1040306941 8:46216951-46216973 GGGAGAAGTGGCAAGACTGCAGG + Intergenic
1040316389 8:46263141-46263163 GAGAGAAGTGGCAAGACCGCAGG + Intergenic
1040333791 8:46405874-46405896 GGGAGAAGTGGCAAGTCTGGAGG + Intergenic
1040334538 8:46409375-46409397 GGGAGAAGTGGGGAGACTGCAGG + Intergenic
1040972304 8:53149447-53149469 GAAAGAAGCTGGAAGTCTTGTGG - Intergenic
1041609913 8:59833516-59833538 GAGGGCAGTTGGAAGGCTACTGG + Intergenic
1042331310 8:67583527-67583549 TGGAGAAGTTGAAAGTCTGTAGG + Intronic
1042822356 8:72944214-72944236 GAGAGAAGGTGGAAGTGTACAGG + Intergenic
1045109437 8:98926206-98926228 GAGAGCAGCTGGAACTCTGCAGG + Intronic
1047794286 8:128238431-128238453 GAGGGAAGTTGGGGGTCTGTGGG + Intergenic
1048196336 8:132334884-132334906 GAGAGAAGTCAGAAGTGTGGGGG - Intronic
1048389496 8:133948108-133948130 GAGAGAAGGTAGCTGTCTGCAGG - Intergenic
1049550667 8:143257149-143257171 GAGAGGAGCTGGAAGTCAGGAGG + Intronic
1050129553 9:2397166-2397188 GAAAGAGGTTGGAAGTCTCCAGG - Intergenic
1050607661 9:7318071-7318093 AAGAGTACTGGGAAGTCTGCAGG - Intergenic
1051108479 9:13607956-13607978 GACAGCATTTGGAAGGCTGCTGG + Intergenic
1051693355 9:19741296-19741318 GAGGGAAGTGGGAAGCCTGTAGG + Intronic
1051701606 9:19830106-19830128 GAGATAACTTGGAACTCTGCTGG - Intergenic
1052365333 9:27606290-27606312 TAGAGAAGATAGAAGTCTGCTGG + Intergenic
1053216448 9:36274581-36274603 CAGAGAAGTTGGAAGTAGGCAGG - Intronic
1053294995 9:36906382-36906404 GAGAGAAGATGCTACTCTGCTGG + Intronic
1055688895 9:78808760-78808782 GAGAGAGGGTGGGAGTCAGCAGG - Intergenic
1056563020 9:87749149-87749171 GACAGAAGTAAGAAGTGTGCTGG + Intergenic
1058131653 9:101260409-101260431 GAGAGAATGTGGAAGCCTGAAGG + Intronic
1059504411 9:114785130-114785152 GAATGAAGTTGAAAGACTGCTGG + Exonic
1059763776 9:117363852-117363874 GAGAAAAGATAGATGTCTGCCGG - Intronic
1061345882 9:130024596-130024618 GAGAGAAGTTGGAAGTAGTTGGG - Intronic
1061874090 9:133535344-133535366 GAGTGCAGATGGAGGTCTGCAGG + Intronic
1187480291 X:19648869-19648891 GAGGGAAGCTGGAAGGCTGACGG - Intronic
1187565246 X:20443248-20443270 GTGAGCAGTTGGAAGTGTGTGGG + Intergenic
1187704052 X:21991933-21991955 GAGATATACTGGAAGTCTGCTGG - Intronic
1188488444 X:30709352-30709374 GATAGAAGTTGGATGGCTACTGG - Intronic
1189655380 X:43239469-43239491 GAGAGATAATGGAAGTCTGCAGG + Intergenic
1191898110 X:66014933-66014955 GAGAGAAGTTGGAAGTAAAATGG + Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1195040293 X:101007930-101007952 GAGAGATGATGGAAGCCTGCAGG + Intergenic
1197114091 X:122811481-122811503 GAAAGAAGTTGGAAGCTAGCAGG + Intergenic
1197114161 X:122812576-122812598 AACAGAAGTTTGAAGTGTGCTGG + Intergenic
1199641605 X:149867831-149867853 GAGAGAGGTTGTGAGTCTGAGGG + Intergenic
1199676624 X:150195051-150195073 GAGAGAAGTTGGAGCACAGCAGG - Intergenic
1200875737 Y:8152773-8152795 GAAAGATGTTTGAAGTCTTCAGG + Intergenic
1202354575 Y:24032500-24032522 CAGTGAAGTTGGAAGTTTCCTGG - Intergenic
1202516203 Y:25637612-25637634 CAGTGAAGTTGGAAGTTTCCTGG + Intergenic