ID: 923861089

View in Genome Browser
Species Human (GRCh38)
Location 1:237892771-237892793
Sequence AACCCCAGACCCACCCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 491}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923861089_923861097 19 Left 923861089 1:237892771-237892793 CCATCCTGGGTGGGTCTGGGGTT 0: 1
1: 0
2: 4
3: 58
4: 491
Right 923861097 1:237892813-237892835 GACCCATAACCTTGCAGCGTGGG 0: 1
1: 0
2: 1
3: 156
4: 389
923861089_923861096 18 Left 923861089 1:237892771-237892793 CCATCCTGGGTGGGTCTGGGGTT 0: 1
1: 0
2: 4
3: 58
4: 491
Right 923861096 1:237892812-237892834 AGACCCATAACCTTGCAGCGTGG 0: 1
1: 0
2: 3
3: 160
4: 401
923861089_923861100 27 Left 923861089 1:237892771-237892793 CCATCCTGGGTGGGTCTGGGGTT 0: 1
1: 0
2: 4
3: 58
4: 491
Right 923861100 1:237892821-237892843 ACCTTGCAGCGTGGGCATCATGG 0: 1
1: 21
2: 104
3: 226
4: 476
923861089_923861091 -6 Left 923861089 1:237892771-237892793 CCATCCTGGGTGGGTCTGGGGTT 0: 1
1: 0
2: 4
3: 58
4: 491
Right 923861091 1:237892788-237892810 GGGGTTCCTTGCCCTTATTCCGG 0: 1
1: 10
2: 255
3: 171
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923861089 Original CRISPR AACCCCAGACCCACCCAGGA TGG (reversed) Intergenic
900086164 1:898533-898555 AACACCTGACCCGCCCAGGGTGG - Intergenic
900379687 1:2377716-2377738 GACCCAGGACCCCCCCAGGAGGG - Intronic
901237871 1:7677213-7677235 TACCCGAGCCCCACCCAGGAAGG + Intronic
902336446 1:15757610-15757632 AGCCCCAGAGCCACCCTGGAGGG + Intronic
902703198 1:18186892-18186914 GATCCCAGACACAGCCAGGAAGG - Intronic
902904694 1:19547329-19547351 AACACCTGGCCCACCCAGGGTGG + Intergenic
903140183 1:21334648-21334670 AATCCCAAGCCCACCCCGGAAGG + Intronic
903178659 1:21594782-21594804 AACCCCAGCCCCACCCAACTCGG - Intergenic
903258646 1:22119325-22119347 CTCCCCAGACCCACCTAGGCAGG - Exonic
903278072 1:22234015-22234037 AACCCCAGACTCATCCATCATGG - Intergenic
904222524 1:28984157-28984179 AACCCCAGACTCAGCTGGGAGGG - Intronic
904256321 1:29257272-29257294 GTCCCCATCCCCACCCAGGAAGG - Intronic
904324029 1:29715829-29715851 AACACCTGGCCCACCCAGGGTGG + Intergenic
904440000 1:30524099-30524121 AACCTCAGACCCACCAAAAAAGG - Intergenic
904574248 1:31492794-31492816 AACACCTGGCCCACCCAGGGTGG - Intergenic
904922751 1:34021483-34021505 ACTCCCAGCCCCTCCCAGGATGG - Intronic
906009741 1:42512178-42512200 AACACCTGGCCCACCCAGGGTGG - Intronic
906043070 1:42804540-42804562 AACACCTGGCCCACCCAGGGTGG - Intergenic
906141641 1:43537189-43537211 ACCCCCACCCCCACCCAGGATGG + Intronic
906211768 1:44016174-44016196 CACCCCAGACAAGCCCAGGAGGG + Intronic
906774161 1:48513592-48513614 AACACCTGGCCCACCCAGGGTGG - Intergenic
907098109 1:51800481-51800503 ACCCCCACACCCACCCACTAGGG + Intronic
907239150 1:53071077-53071099 AGCTCCAGCCCAACCCAGGAAGG + Intronic
907435064 1:54440350-54440372 TTCCTCACACCCACCCAGGAGGG + Intergenic
907834872 1:58099191-58099213 AACCCCAGTCTCACCCAGGTTGG + Intronic
911136926 1:94450446-94450468 AACACCTGGCCCACCCAGGGCGG + Intronic
911977374 1:104516337-104516359 AACACCTGGCCCACCCAGGGTGG - Intergenic
912933815 1:113985946-113985968 AACACCTGGCCCACCCAGGGCGG - Intergenic
914048449 1:144111228-144111250 AACCCCAAACCCACCCTAAAGGG + Intergenic
914130735 1:144854220-144854242 AACCCCAAACCCACCCTAAAGGG - Intergenic
914768287 1:150659370-150659392 AACACCTGGCCCACCCAGGGCGG + Intronic
915180344 1:154053562-154053584 AACACCTGGCCCACCCAGGGCGG + Intronic
915379643 1:155428610-155428632 AACACCTGGCCCACCCAGGCTGG + Intronic
916360926 1:163967570-163967592 AACACCTGGCCCACCCAGGGTGG + Intergenic
916703010 1:167317682-167317704 AACACCTGGCCCACCCAGGATGG - Intronic
917293271 1:173493233-173493255 AACACCTGGCCCACCCAGGGTGG + Intergenic
917485124 1:175448682-175448704 AACCACACACCCTCCCAGGTGGG + Intronic
917661341 1:177180279-177180301 AACCTCAGAGCCACCCAGGGTGG - Intronic
917799152 1:178554420-178554442 AACACCTGGCCCACCCAGGGCGG - Intergenic
918245599 1:182656763-182656785 AGGTCCAGACCCTCCCAGGAAGG - Intronic
919083363 1:192891944-192891966 GGCCACAGCCCCACCCAGGAGGG + Intergenic
920427634 1:205890835-205890857 AACACCTGGCCCACCCAGGGTGG + Intergenic
920428184 1:205895791-205895813 AACACCTGGCCCACCCAGGGTGG + Intergenic
921226536 1:213025826-213025848 AACACCTGGCCCACCCAGGGTGG - Intergenic
922507177 1:226133314-226133336 AACACCAGCCCTTCCCAGGAAGG - Intergenic
922810357 1:228411951-228411973 AAGACCAGACCCAACCAGAATGG + Intronic
923084829 1:230695253-230695275 AACCTCAAACCATCCCAGGAAGG + Intergenic
923247774 1:232149770-232149792 AACCCTAGTCCCACCCACGAGGG + Intergenic
923282001 1:232452388-232452410 AACTTCAGAGGCACCCAGGAAGG + Intronic
923282014 1:232452469-232452491 AACTTCAGAGGCACCCAGGAAGG + Intronic
923861089 1:237892771-237892793 AACCCCAGACCCACCCAGGATGG - Intergenic
924765070 1:247024782-247024804 AACACCTGGCCCACCCAGGGCGG + Intergenic
1063468343 10:6263321-6263343 AACACCTGGCCCACCCAGGGCGG - Intergenic
1063789252 10:9423404-9423426 AACACCTGGCCCACCCAGGGTGG - Intergenic
1064028671 10:11869596-11869618 CACCCCCGATCCCCCCAGGAGGG + Exonic
1064711897 10:18136691-18136713 ATCCCCAGCACCACCCAGCATGG - Intergenic
1065972819 10:30818632-30818654 GACCCAGGACCCACCTAGGAAGG + Intergenic
1066049173 10:31619173-31619195 CAGCCCAGCCCCACCCATGAGGG - Intergenic
1066541988 10:36457377-36457399 AACACCTGGCCCACCCAGGGCGG + Intergenic
1067082085 10:43217614-43217636 AGCCCCAGACTCTCCCAGGCAGG - Intronic
1067133912 10:43591617-43591639 AACACCTGGCCCACCCAGGGTGG + Intergenic
1069413405 10:68175615-68175637 AACCGCAGATCCACACAGGCAGG - Intronic
1069491122 10:68861413-68861435 AACACCTGGCCCACCCAGGGTGG - Intronic
1069491945 10:68868446-68868468 AACACCTGGCCCACCCAGGGTGG - Intronic
1070467322 10:76736650-76736672 AAGCCATGACACACCCAGGAAGG + Intergenic
1070628167 10:78066027-78066049 AACCCCAGAGCCACTCTTGATGG - Intergenic
1070745538 10:78931481-78931503 AGCCCCACACCCACCCGAGAGGG - Intergenic
1070894982 10:79975919-79975941 AACACCTGGCCCACCCAGGGTGG - Intronic
1071119561 10:82261801-82261823 AACACCTGGCCCACCCAGGGCGG - Intronic
1071372534 10:84966868-84966890 ATCCCCTGACCCACTCAGGCAGG - Intergenic
1071444679 10:85734947-85734969 AGCGCCAGACCCCCTCAGGATGG - Intronic
1072562448 10:96588253-96588275 AACACCAGACCCACTCAGTCTGG + Intergenic
1074579444 10:114704682-114704704 GACCCCACAGCCTCCCAGGAAGG - Intergenic
1074767091 10:116707415-116707437 AGGCCCAGCCCCAGCCAGGAAGG + Intronic
1074872672 10:117589238-117589260 AACCTCACAAACACCCAGGAAGG - Intergenic
1075913056 10:126142501-126142523 AACACCTGGCCCACCCAGGGCGG - Intronic
1076510195 10:131008033-131008055 AAACCCAGGCCCAACCTGGAGGG + Intergenic
1076529534 10:131135351-131135373 CATCGCAGACCCTCCCAGGAAGG - Intronic
1076727889 10:132421829-132421851 CCCCCCAGCCACACCCAGGAAGG - Intergenic
1077055438 11:590152-590174 AACCCCAGTCCCACCATGGGGGG + Intronic
1077069037 11:659421-659443 AAACCTAGACACACCCCGGATGG + Intronic
1077108755 11:853039-853061 ACCCACAGCCACACCCAGGACGG - Intronic
1077180461 11:1210150-1210172 AACACCTGGCCCACCCAGGGTGG + Intergenic
1077210072 11:1366720-1366742 AACACCTGGCCCACCCAGGGCGG - Intergenic
1077323602 11:1953637-1953659 AACCCCATCCCCACCCAGTAAGG - Intronic
1078097626 11:8310378-8310400 AAACCCAGACCCAACAGGGAGGG - Intergenic
1078689354 11:13563405-13563427 AACACCTGGCCCACCCAGGGTGG - Intergenic
1078836536 11:15035455-15035477 AGCCGCAGCCCCGCCCAGGAGGG + Intronic
1079375631 11:19889189-19889211 AAGCCCGGACTCACCCAGGAGGG - Intronic
1081186484 11:40049006-40049028 AACACCTGGCCCACCCAGGGCGG + Intergenic
1082110918 11:48272814-48272836 AAGCCCAGACCCACCCAGCAAGG + Intergenic
1082280364 11:50265261-50265283 AACACCTGGCCCACCCAGGGTGG + Intergenic
1082965940 11:58966199-58966221 AACACCTGGCCCACCCAGGGAGG + Intronic
1083326628 11:61876316-61876338 ACCCCCCACCCCACCCAGGATGG + Intronic
1083822986 11:65182979-65183001 TAGCCGAGTCCCACCCAGGATGG - Intronic
1084024973 11:66442340-66442362 AACACCTGGCCCACCCAGGATGG - Intronic
1084432672 11:69120199-69120221 ACCCCCAGACCTCCCCAGCAAGG - Intergenic
1084517643 11:69645159-69645181 CACCCCAGACCCATCCAGACTGG - Intronic
1084790097 11:71469672-71469694 AACACCTGGCCCACCCAGGGCGG - Intronic
1085355601 11:75833872-75833894 AACACCTGGCCCACCCAGGGTGG - Intronic
1085391116 11:76182804-76182826 AACCCCAGACCCAGAGAGGCTGG - Intergenic
1086066334 11:82749314-82749336 AACACCTGGCCCACCCAGGGCGG - Intergenic
1086522579 11:87687287-87687309 AACACCTGACCCACCCAGGGAGG + Intergenic
1087500460 11:98945422-98945444 AACACCTGGCCCACCCAGGGCGG - Intergenic
1087749485 11:101990914-101990936 AAACCCAAACCCACTCAGGGAGG + Intronic
1089137759 11:116263359-116263381 AACCCCACCCCAACCCTGGAAGG + Intergenic
1089498256 11:118918594-118918616 AACCCTAGACCCAGTCAGGTGGG - Intronic
1089567110 11:119377693-119377715 AACCCCTGACTCACCCAGCATGG - Intronic
1089936892 11:122373827-122373849 CACTTCATACCCACCCAGGATGG - Intergenic
1090305451 11:125687426-125687448 AACACCTGGCCCACCCAGGGCGG + Intergenic
1091367000 11:135030740-135030762 AACACAAGCCCCACCCAGAAAGG - Intergenic
1202806589 11_KI270721v1_random:8832-8854 AACCCCATCCCCACCCAGTAAGG - Intergenic
1091678706 12:2510755-2510777 AACTCCAAACCCACCCCAGAGGG + Intronic
1091911402 12:4233241-4233263 AACCCCAAACCAATCCTGGATGG + Intergenic
1092309991 12:7342246-7342268 AACAGCTGACCCACCCAGGGTGG + Intergenic
1092473965 12:8803328-8803350 AACACCTGGCCCACCCAGGGTGG - Intergenic
1094342117 12:29424311-29424333 AACACCTGGCCCACCCAGGATGG - Intronic
1094461031 12:30696677-30696699 AACCCCAGACCCTAGCAGGCAGG + Intergenic
1094728894 12:33151979-33152001 AACACCTGGCCCACCCAGGGTGG - Intergenic
1095912559 12:47443684-47443706 AACACCTGGCCCACCCAGGGCGG - Intergenic
1096125058 12:49113096-49113118 AACACCTGGCCCACCCAGGGCGG - Intergenic
1096789142 12:54034245-54034267 AACCCCACCCCAAGCCAGGAAGG - Intronic
1096846955 12:54412590-54412612 AAACACAGACCCAGCCAGGAAGG - Intronic
1096870912 12:54591552-54591574 ACCCTCACAACCACCCAGGAGGG + Intergenic
1097055707 12:56247954-56247976 AGCCCCATTCCCATCCAGGAGGG + Intronic
1097492302 12:60285190-60285212 AACACCTGGCCCACCCAGGGCGG - Intergenic
1097810156 12:64010385-64010407 ACCCCCAGAACCTCCCAGAAAGG - Intronic
1101217942 12:102603754-102603776 CATCCCCTACCCACCCAGGAAGG - Intergenic
1101556519 12:105814916-105814938 AACCCCAAAGCCACACATGAAGG - Intergenic
1101650274 12:106671378-106671400 ACCCCCAGAGCCACCCAGGAAGG - Intronic
1101992231 12:109495829-109495851 AACACCTGGCCCACCCAGGGTGG - Intronic
1102322243 12:111946550-111946572 AACACCTGGCCCACCCAGGGTGG - Intronic
1104013558 12:124948271-124948293 CCCACCAGCCCCACCCAGGAGGG + Intronic
1104744902 12:131204456-131204478 GACCCCAGAACTAACCAGGAAGG - Intergenic
1105352244 13:19626466-19626488 AACACCTGGCCCACCCAGGGTGG + Intergenic
1105699706 13:22926762-22926784 GACCCCAGACCCAGCGAGGAGGG - Intergenic
1105703441 13:22951187-22951209 AACACCTGTCCCACCCAGGGGGG + Intergenic
1105704514 13:22960926-22960948 GACCCCTGCCCCTCCCAGGAAGG + Intergenic
1105856088 13:24373400-24373422 AACACCTGGCCCACCCAGGGCGG + Intergenic
1105978538 13:25495169-25495191 AAGCCCAGCCCCACCCTGGAAGG - Intronic
1106242345 13:27921664-27921686 GACCCCAGGCGCAGCCAGGAGGG + Intronic
1106416795 13:29552567-29552589 AACACCTGGCCCACCGAGGATGG + Intronic
1107091893 13:36490365-36490387 AACTGCAGACTAACCCAGGAGGG + Intergenic
1108972329 13:56392862-56392884 AACACCTGGCCCACCCAGGGCGG - Intergenic
1109532940 13:63676777-63676799 AACCCCAAAGTCACCCAGGAAGG + Intergenic
1112005706 13:95251951-95251973 TCCCACAAACCCACCCAGGATGG + Intronic
1114677703 14:24455240-24455262 AACACCTGGCCCACCCAGGGTGG - Intergenic
1115959466 14:38819383-38819405 AACACCTGGCCCACCCAGGGCGG + Intergenic
1116027656 14:39534690-39534712 AACGCCTGGCCCACCCAGGGTGG - Intergenic
1116664265 14:47754675-47754697 AACACCTGGCCCACCCAGGGTGG - Intergenic
1118479115 14:66145557-66145579 AACCCCTGGCCCATCCAGGATGG + Intergenic
1118949927 14:70426799-70426821 AACACCTGGCCCACCCAGGGTGG - Intergenic
1119088708 14:71760430-71760452 TACCCCATACCCACCCAAGCAGG - Intergenic
1119423744 14:74523105-74523127 ACCCCGAGCCCTACCCAGGATGG + Intronic
1119846584 14:77834935-77834957 TATCCCAGACCAACCCAGGCTGG + Intronic
1120323424 14:82994722-82994744 AACACCTGGCCCACCCAGGGCGG + Intergenic
1120480744 14:85046492-85046514 AACACCTGGCCCACCCAGGGTGG + Intergenic
1122652687 14:103234142-103234164 AACACCTGGCCCACCCAGGGCGG + Intergenic
1122810514 14:104285408-104285430 ACCCCCAGTCCTACCCAGGAGGG - Intergenic
1122953790 14:105060654-105060676 AACGCCTGAGCCGCCCAGGAAGG + Intronic
1123049884 14:105536101-105536123 CTGCCCAGACTCACCCAGGAGGG - Intergenic
1123707130 15:22958803-22958825 AACCCCAGAGTGCCCCAGGAGGG + Intronic
1123788495 15:23695961-23695983 AACACCTGGCCCACCCAGGGTGG - Intergenic
1124809619 15:32922131-32922153 ATCCTCAGGCACACCCAGGATGG - Intronic
1128835329 15:70804754-70804776 AACACCTGGCCCACCCAGGGCGG + Intergenic
1129461099 15:75700444-75700466 AGCCCCAGAGCCACAGAGGAGGG - Intronic
1131165549 15:90139742-90139764 AACACCTGGCCCACCCAGGGCGG - Intergenic
1132555184 16:569143-569165 TCCCCCAGACCCTCCCAGCACGG - Exonic
1132587069 16:710239-710261 GACCCCAGCTCCACCCAGGGAGG + Intronic
1132765338 16:1531611-1531633 AGCCACAGATCCTCCCAGGAGGG + Intronic
1132880128 16:2158464-2158486 AACCCCAGAAGCACCCAGGTGGG + Intronic
1133025140 16:2985908-2985930 ACCCCCAGACCCACCCAGGCAGG - Intergenic
1133223861 16:4330925-4330947 AACACCTGGCCCACCCAGGGCGG + Intronic
1134067320 16:11237083-11237105 AAGCCCAGGCCCAGCCAGAATGG - Intergenic
1135180847 16:20272957-20272979 AACCCCATACCCACCCACAGAGG + Intergenic
1136638671 16:31543031-31543053 AACACCTGGCCCACCCAGGGTGG + Intergenic
1136659113 16:31739835-31739857 AACACCTGGCCCACCCAGGGTGG + Intronic
1136686401 16:31997189-31997211 AGCCCCGGAACCTCCCAGGAGGG + Intergenic
1136882760 16:33913071-33913093 AGCCCCGGAACCTCCCAGGAGGG - Intergenic
1137001346 16:35233380-35233402 AAGCCCCCACCCACCCAGGGAGG + Intergenic
1138304110 16:55958456-55958478 ACAGCCAGACCCATCCAGGATGG + Intergenic
1140782662 16:78310861-78310883 AGCCCCAGACCCACCTTCGAGGG + Intronic
1141097403 16:81172633-81172655 AACCCAAGACACAGCCGGGATGG - Intergenic
1141480236 16:84301570-84301592 ACCCCCAGCAGCACCCAGGAGGG + Intronic
1141688835 16:85585293-85585315 AACCAGAGGCCCATCCAGGATGG + Intergenic
1142344990 16:89548160-89548182 AACCCCAGAAATACCCAGGCAGG + Intronic
1142371416 16:89685033-89685055 AACACCTGGCCCACCCAGGGCGG + Intronic
1142416745 16:89947340-89947362 AACACCTGGCCCACCCAGGGCGG + Intergenic
1203089251 16_KI270728v1_random:1202388-1202410 AGCCCCGGAACCTCCCAGGAGGG + Intergenic
1142475414 17:185975-185997 AACACCCGGCCCGCCCAGGACGG + Intergenic
1142743125 17:1942074-1942096 CACCCCTGGCCCACCCAGGAGGG - Intronic
1142922238 17:3199278-3199300 AAACCTAGACCCTCCAAGGAGGG + Intergenic
1143369001 17:6426799-6426821 AACCCCCGCCCCACCCTGGCCGG + Intronic
1143430101 17:6875493-6875515 AACACCTGGCCCGCCCAGGATGG - Intergenic
1143430736 17:6881364-6881386 AACACCTGGCCCGCCCAGGACGG - Intronic
1143480872 17:7226726-7226748 TCTCCCAGACCCACCCACGATGG + Intronic
1145216606 17:21057304-21057326 TACCCCAGACCAGCCCTGGATGG + Intergenic
1145800963 17:27684395-27684417 AACACCTGGCCCACCCAGGTTGG + Intergenic
1146038835 17:29432354-29432376 AACACCTGGCCCACCCAGGATGG - Intronic
1146294450 17:31638667-31638689 AACACCTGGCCCACCCAGGGTGG + Intergenic
1146571657 17:33958245-33958267 GACCCCAGACCCCTCCAGAATGG - Intronic
1147215856 17:38898638-38898660 TTCCCCAGGCCCACCCTGGAGGG - Intronic
1147870192 17:43581765-43581787 GACCGCAGGCCCACCCAGCAGGG - Intergenic
1148168298 17:45499583-45499605 AATCCCAGACCCAGCCTGGGGGG + Intergenic
1148280515 17:46343368-46343390 AATCCCAGACCCAGCCTGGGGGG - Intronic
1148302743 17:46561303-46561325 AATCCCAGACCCAGCCTGGGGGG - Intronic
1148460909 17:47838526-47838548 CACGCCAGACCCATCCAGGTGGG - Exonic
1148639017 17:49170990-49171012 AACACCTGGCCCACCCAGGGTGG - Intergenic
1148639596 17:49176539-49176561 AACACCTGTCCCACCCAGGGGGG - Intergenic
1149139710 17:53417234-53417256 AACACCTGGCCCACCCAGGGTGG - Intergenic
1149868974 17:60166129-60166151 AACACCAGAATCACACAGGAGGG - Intronic
1150399487 17:64846009-64846031 AATCCCAGACCCAGCCTGGGGGG + Intergenic
1150992951 17:70282101-70282123 AACACCTGGCCCACCCAGGGTGG + Intergenic
1151535638 17:74737413-74737435 CAACCCAGACGCAGCCAGGAAGG - Intronic
1151670356 17:75568801-75568823 GACCCCAGCCCCACCCCAGAGGG + Exonic
1151718178 17:75842185-75842207 ACCCCCAGACTCACCCACAAGGG + Intronic
1152064261 17:78101808-78101830 AACACCAGGCCCACCCAGGGCGG - Intronic
1153159504 18:2187801-2187823 AAGCCAAGAGTCACCCAGGAGGG + Intergenic
1153351639 18:4087355-4087377 AACACCTGGCCCACCCAGGGCGG + Intronic
1155249017 18:23938077-23938099 ATTCCCAGAAGCACCCAGGATGG - Intronic
1155885632 18:31205093-31205115 AACCCCAGACCCACACTTCATGG + Intergenic
1156410970 18:36828420-36828442 AACCAAGGTCCCACCCAGGAAGG - Intronic
1156447657 18:37249210-37249232 GCCCTTAGACCCACCCAGGATGG + Intronic
1157384425 18:47249059-47249081 AACCTCAAACCCAACCAGGTGGG - Exonic
1157671276 18:49530857-49530879 AACACCTGGCCCACCCAGGGCGG - Intergenic
1158087619 18:53671779-53671801 AACACCTGGCCCACCCAGGGCGG + Intergenic
1158622056 18:59041314-59041336 GACCCCAGACCAACCCAGGTGGG - Intergenic
1159059077 18:63495538-63495560 GACCCCAGAGCCAGCCTGGAAGG + Intronic
1159823474 18:73176083-73176105 AACCACACACCCACCCATTAGGG - Intronic
1159854814 18:73573143-73573165 AACTCCAGACCCACCCAAGCTGG - Intergenic
1159937592 18:74381564-74381586 AACACCTGGCCCACCCAGGGTGG - Intergenic
1160497406 18:79383514-79383536 ATGCCCAGACCAGCCCAGGATGG - Intergenic
1160678367 19:402188-402210 GGCCTCAGACCCACCCAGGCGGG - Intergenic
1160923160 19:1529901-1529923 ACCCCCAGAAATACCCAGGAGGG - Intronic
1161055873 19:2190418-2190440 CAGCCCAGTCCCACTCAGGAGGG - Intronic
1161249936 19:3275242-3275264 CAGCCCAGCCCCACCCAGCAGGG + Intronic
1161273821 19:3404594-3404616 CACCCCCACCCCACCCAGGAGGG + Intronic
1161388727 19:4010318-4010340 AGCCCCTGCCCCACCCAGGCTGG - Intronic
1161421237 19:4176953-4176975 GCCCCCAGATCCCCCCAGGAGGG + Intronic
1161440751 19:4290393-4290415 CATCCCGGACCCACCCAGAAAGG - Intronic
1161552795 19:4923405-4923427 AGTCCCAGCCCCACCCAAGACGG - Intronic
1161907287 19:7166281-7166303 AATCACAGAACCACCCAGGGTGG - Exonic
1162140144 19:8580635-8580657 CTCCCCAGACCCACCCTGGAGGG + Exonic
1162252999 19:9462260-9462282 AACACCTGGCCCACCCAGGGCGG + Intergenic
1162643014 19:12027467-12027489 AACACCTGGCCCACCCAGGGCGG + Intronic
1162652864 19:12104126-12104148 AACGCCTGGCCCACCCAGGGCGG - Intronic
1162673394 19:12278142-12278164 AACACCTGGCCCACCCAGGGTGG + Intronic
1163117371 19:15196487-15196509 CACCCCAGACCCACCCAGCTTGG + Intronic
1163233067 19:16016719-16016741 ATCCCCAGGACCACCCAGCATGG + Intergenic
1163258319 19:16171403-16171425 GACCTCAGACCCACCAAGGATGG - Intronic
1163642311 19:18468770-18468792 AACCCCAGCTCCACCCAGGTTGG + Intronic
1164025166 19:21345124-21345146 AACACCTGGCCCACCCAGGGTGG - Intergenic
1164032338 19:21418852-21418874 AACACCTGGCCCACCCAGGAAGG - Intronic
1164322626 19:24163524-24163546 AACACCTGGCCCACCCAGGGTGG - Intergenic
1165865630 19:38935510-38935532 AACACCTGGCTCACCCAGGATGG - Intronic
1165866320 19:38941672-38941694 AACACCTGGCCCACCCAGGGCGG - Exonic
1166504582 19:43362993-43363015 AGCCCAATACACACCCAGGATGG + Exonic
1166504924 19:43365138-43365160 AAGCCCAGTCCCCTCCAGGATGG + Intergenic
1166505616 19:43369776-43369798 AAGCCCAGTCCCCTCCAGGATGG - Intergenic
1166505978 19:43372047-43372069 AGCCCAATACACACCCAGGATGG - Intergenic
1166921318 19:46230865-46230887 TTCTCCAGGCCCACCCAGGAAGG - Exonic
1202687902 1_KI270712v1_random:64126-64148 AACCCCAAACCCACCCTAAAGGG + Intergenic
925280821 2:2683261-2683283 CACCACACACACACCCAGGAAGG - Intergenic
925450470 2:3965085-3965107 AACCACCTTCCCACCCAGGAAGG - Intergenic
926697650 2:15782007-15782029 AAGCCCAGACACACCCAAGAGGG - Intergenic
929880870 2:45836570-45836592 ATCCCCAGACCCACCTGGCATGG - Intronic
930316546 2:49803034-49803056 AACACCTGGCCCACCCAGGGCGG - Intergenic
931469427 2:62523434-62523456 AACCCCAAACAAACCCAAGAGGG - Intergenic
932416294 2:71575543-71575565 AACACCAGCCCCACCCCAGAAGG - Intronic
932845267 2:75128594-75128616 AACCCCAGTCCCACCCCTGAGGG - Intronic
934764906 2:96875273-96875295 AACCCCATCCAAACCCAGGAAGG + Intergenic
935025314 2:99270998-99271020 AACACCTGGCCCACCCAGGGTGG - Intronic
935047700 2:99497209-99497231 AACCAGAGACCGTCCCAGGAGGG - Intergenic
935240629 2:101175089-101175111 AACACCTGGCCCACCCAGGGTGG - Intronic
935520251 2:104095728-104095750 AACACCTGGCCCACCCAGGGCGG - Intergenic
935598408 2:104897595-104897617 AACCCCAGCCCCGCCCATGTGGG + Intergenic
936067428 2:109343101-109343123 GCCTCCACACCCACCCAGGAGGG - Intronic
936154273 2:110037874-110037896 TACCCCTGACCCTCCCAGCATGG + Intergenic
936171793 2:110183272-110183294 AACACCTGGCCCACCCAGGGCGG + Intronic
936190410 2:110333541-110333563 TACCCCTGACCCTCCCAGCATGG - Intergenic
936771161 2:115915076-115915098 AACACCTGGCCCACCCAGGGCGG + Intergenic
937170983 2:119868597-119868619 AACACCTGGCCCACCCAGGGCGG + Intronic
937908518 2:127064353-127064375 GACCCCAGACCCAGCCAAGTGGG + Intronic
938593595 2:132764197-132764219 AACCAGAGAACCAGCCAGGAGGG + Intronic
938850547 2:135255161-135255183 AAGACCAGACCAAACCAGGATGG + Intronic
939716780 2:145594042-145594064 CACACAAGTCCCACCCAGGAGGG + Intergenic
940168775 2:150803958-150803980 AACCCCAGATTCAGTCAGGAGGG - Intergenic
940301621 2:152181281-152181303 AACACCTGGCCCACCCAGGACGG - Intergenic
941249634 2:163146374-163146396 AACACCTGGCCCACCCAGGGCGG - Intergenic
941915876 2:170813731-170813753 AATCCCCCACCCACCCACGACGG + Intronic
943466124 2:188231177-188231199 AACACCTGGCCCACCCAGGGCGG - Intergenic
943901769 2:193447791-193447813 AACACCTGGCCCACCCAGCAAGG - Intergenic
944586544 2:201178500-201178522 AACACCTGGCCCACCCAGGGCGG - Intergenic
944636669 2:201681755-201681777 GACCCCAGAACCACACAGCAGGG - Intronic
945292336 2:208138537-208138559 AACACCTGGCCCACCCAGGTCGG - Intergenic
945455020 2:210041731-210041753 AAATCCAGACCCAGCCAGGTGGG - Intronic
946201254 2:218072110-218072132 ATCCCCAGACACACAGAGGAGGG + Intronic
946206955 2:218116638-218116660 AACACCTGGCCCACCCAGGGCGG + Intergenic
947523248 2:230864321-230864343 CACCCCAGGACCCCCCAGGAAGG + Intergenic
947903486 2:233742428-233742450 AACACCTGGCCCACCCAGGGAGG - Intronic
947977985 2:234384268-234384290 AACACCTGGCCCACCCAGGGTGG + Intergenic
949076368 2:242061347-242061369 CTCCCCAGACACACCCAGGTGGG + Intergenic
1168730527 20:75039-75061 AACCTCACACCCACAAAGGAAGG + Intergenic
1168936702 20:1671862-1671884 AACACCTGGCCCACCCAGGGTGG - Intergenic
1171228976 20:23467069-23467091 AACACCTGGCCCACCCAGGGTGG + Intergenic
1171288937 20:23968954-23968976 AGCCCCAAACCCTCCCATGATGG + Intergenic
1171986583 20:31665292-31665314 GAGGCCAGCCCCACCCAGGAGGG - Exonic
1172097957 20:32469815-32469837 AACCCCAGACTCCTCCAGGGAGG + Intronic
1172119876 20:32592015-32592037 TACCCCAGCCTCACCCAGGCAGG + Intronic
1172271635 20:33658630-33658652 GAACCCTGACCCACCCAGGATGG + Intronic
1172715787 20:36962459-36962481 AACACCTGGCCCACCCAGGGTGG + Intergenic
1173631537 20:44520014-44520036 CACCCCTGACCCTCCAAGGAGGG + Intronic
1174179600 20:48666423-48666445 AAGCCCACAACCACCCAAGAAGG + Intronic
1175059040 20:56224930-56224952 AACACCTGGCCCACCCAGGGTGG + Intergenic
1175160116 20:57002168-57002190 CACCCCACACCCACCAGGGAGGG + Intergenic
1175732981 20:61366716-61366738 AACACCTGGCCCACCCAGGGCGG - Intronic
1176040045 20:63060548-63060570 AGCCCCAGGGCCAGCCAGGAGGG - Intergenic
1176188159 20:63792934-63792956 AACCCCACACCATCCAAGGAGGG - Intronic
1176287115 21:5024024-5024046 AACCCCTGCCCCACCCACGATGG - Intronic
1177683840 21:24410920-24410942 AACACCTGGCCCACCCAGGGCGG - Intergenic
1178125582 21:29512284-29512306 GACCCCAGAGCCCCCCACGAGGG - Intronic
1178438213 21:32578053-32578075 AACACCTGGCCCACCCAGGGTGG - Intronic
1178764652 21:35438904-35438926 AACCCCAGACACTCCCAAGCTGG + Intronic
1179870066 21:44239451-44239473 AACCCCTGCCCCACCCACGATGG + Intronic
1179943794 21:44656940-44656962 AATCCCAGACCCCCCCAGCATGG + Intronic
1179957084 21:44747333-44747355 AACACCTGGCCCACCCAGGGCGG - Intergenic
1181593748 22:23900352-23900374 AACACCTGGCCCACCCAGGGCGG + Intergenic
1182350308 22:29695612-29695634 TACCCCAGCCCCACACAGGAAGG - Exonic
1183494978 22:38138046-38138068 GACGCTGGACCCACCCAGGATGG + Intronic
1183543156 22:38441424-38441446 ACCCCCAGCCCCACCCATGCTGG - Intronic
1184864520 22:47194875-47194897 AAACCCTGACCCTCCCAGGTTGG - Intergenic
1185189716 22:49427542-49427564 AACCCCAGACCCACTGCAGAAGG - Intronic
949235953 3:1808253-1808275 AACTCCTGGCCCACCCAGGGTGG - Intergenic
951270130 3:20614717-20614739 AACACCTGGCCCACCCAGGGTGG - Intergenic
951960241 3:28310160-28310182 AACCTCAGACACACTCAGGAGGG - Intronic
952878909 3:37970904-37970926 AACCCCAGACCTTCCTAGTAAGG + Intronic
952920170 3:38278508-38278530 AGCCCCTGACCCAACCAAGATGG + Intergenic
953648025 3:44773415-44773437 CACCCCAGCCCCACCCAGAAGGG + Intronic
953723435 3:45376672-45376694 AACACCTGGCCCACCCAGGGCGG - Intergenic
953928276 3:46993355-46993377 AACCCCTGACCCCCTCAGGGTGG + Intronic
954370264 3:50166446-50166468 GGCCCCAGGCCCAGCCAGGAAGG - Intronic
957365056 3:79212128-79212150 AACACCTGGCCCACCCAGGGCGG - Intronic
957675721 3:83361575-83361597 AACACCTGGCCCACCCAGGGTGG + Intergenic
957678612 3:83403757-83403779 AACTGCAGCCCCACCCAGGAGGG - Intergenic
957953875 3:87159232-87159254 AAAACCTGACCCACCCAAGAAGG - Intergenic
959613686 3:108323124-108323146 AACCACAGACCCCCCCACTATGG - Intronic
960015743 3:112885628-112885650 AACACCTGGCCCACCCAGGGCGG + Intergenic
960279349 3:115763964-115763986 AACCTCTGTCCCAGCCAGGATGG - Intergenic
961265383 3:125637546-125637568 AACACCAGGCCCGCCCAGGGCGG - Intergenic
961323139 3:126092239-126092261 AACACCTGGCCCACCCAGGGTGG + Intronic
961365225 3:126395245-126395267 AACCCCAGGCTCACCCAATAGGG + Intronic
961386173 3:126524533-126524555 ACCCCTAGCCCCAGCCAGGAAGG - Intronic
961745891 3:129063213-129063235 ACCCACAGGCCCACCCAGGCTGG - Intergenic
961750513 3:129091391-129091413 AAGCCCAGTCCCACCTGGGAGGG + Intronic
961812122 3:129527946-129527968 AACCTCACAGCCACCCTGGACGG + Intergenic
961821801 3:129579038-129579060 AGCCCCAGATACTCCCAGGAAGG + Intronic
962261286 3:133909688-133909710 AACCCCAAACCAACCCACAAAGG - Intergenic
965557299 3:170031722-170031744 AACACCTGGCCCACCCAGGGCGG - Intergenic
966009472 3:175056854-175056876 AACACCTGGCCCACCCAGGGTGG - Intronic
966296045 3:178424564-178424586 AACACCTGGCCCACCCAGGGCGG - Intronic
966968501 3:185019643-185019665 AACACCTGGCCCACCCAGGGTGG - Intronic
966978809 3:185110682-185110704 AACACCTGGCCCACCCAGGGCGG + Intronic
967179987 3:186895349-186895371 AACACCTGGCCCACCCAGGGCGG + Intergenic
967400006 3:189049836-189049858 ACCCCCAGTACCAGCCAGGATGG + Intronic
967981941 3:195071114-195071136 AAGCCCACACCCACAGAGGAGGG + Intronic
968468525 4:765507-765529 AACCCCAGAGCCAGCTTGGAAGG + Intronic
968855114 4:3114239-3114261 AACACCTGGCCCACCCAGGGTGG - Intronic
968920474 4:3519677-3519699 AAGCCCAGCCCCACACACGAGGG + Intronic
968955914 4:3719350-3719372 AACCCCGAACCCACCCAGCGGGG + Intergenic
968975652 4:3820901-3820923 AAGGGAAGACCCACCCAGGAGGG + Intergenic
969442136 4:7223728-7223750 AAGCCCAGCCCTTCCCAGGAAGG - Intronic
969860748 4:10033738-10033760 GTCCCCAGCCCCACCCAGGTCGG - Intronic
970582856 4:17489294-17489316 AGCCACAGACCCACAGAGGACGG - Intronic
971813921 4:31462844-31462866 AACACCTGGCCCGCCCAGGATGG + Intergenic
971871483 4:32245738-32245760 AACACCTGGCCCACCCAGGGCGG + Intergenic
973008346 4:45042192-45042214 AACACCTGGCCCACCCAGGGTGG + Intergenic
973009025 4:45048656-45048678 AACACCTGGCCCACCCAGGGCGG + Intergenic
974566125 4:63579942-63579964 AACACCTGACCCACCCAGGGCGG + Intergenic
974635752 4:64562776-64562798 AACACCTGGCCCACCCAGGGTGG + Intergenic
974636459 4:64569454-64569476 AACACCTGGCCCACCCAGGGCGG + Intergenic
975353306 4:73369904-73369926 AACACCTGGCCCACCCAGGGTGG + Intergenic
976045199 4:80938335-80938357 AACACCTGGCCCACCCAGGGCGG + Intronic
976549617 4:86379555-86379577 AACACCTGGCCCACCCAGGGAGG + Intronic
977642516 4:99372764-99372786 AACACCTGGCCCACCCAGGGTGG + Intergenic
978032410 4:103951257-103951279 AACACCTGGCCCACCCAGGGTGG - Intergenic
979982848 4:127277308-127277330 AACACCTGGCCCACCCAGGGTGG - Intergenic
980866922 4:138562781-138562803 AACCTCAGGCCCATCCAGAATGG + Intergenic
981443167 4:144806471-144806493 TCCCCCAGGCCCACCCAGGCTGG + Intergenic
981813862 4:148806497-148806519 AACACCTGGCCCACCCAGGGTGG - Intergenic
982519321 4:156393279-156393301 AACACCTGGCCCACCCAGGGCGG + Intergenic
983548866 4:168994316-168994338 AACACCTGGCCCACCCAGGGTGG - Intronic
984148208 4:176090983-176091005 AACACCTGGCCCACCCAGGGTGG - Intronic
984935830 4:184888776-184888798 CACCCCAGAGGCAGCCAGGAAGG + Intergenic
985538165 5:475850-475872 AGCTGCAGACCCACCCAGGATGG - Intronic
985736760 5:1587371-1587393 AACACCTGGCCCACCCAGGGCGG - Intergenic
986007823 5:3683049-3683071 GACCCCAGAACCACTCAGGCCGG - Intergenic
986954638 5:13136157-13136179 AACACCAGGCCCGCCCAGGGTGG - Intergenic
988088822 5:26508364-26508386 AACCCCAGACCCAGCCACACTGG + Intergenic
988810672 5:34782100-34782122 AACACCTGGCCCACCCAGGGTGG - Intronic
988844645 5:35115721-35115743 TGCCCCATACCCACCCAGGGTGG - Intronic
989154666 5:38332809-38332831 AACACCTGGCCCACCCAGGGTGG - Intronic
989759051 5:44989964-44989986 AACACCTGGCCCACCCAGGGTGG + Intergenic
990306485 5:54498565-54498587 AACACCTGGCCCACCCAGGGCGG - Intergenic
990307218 5:54505263-54505285 AACACCTGGCCCACCCAGGGCGG - Intergenic
990886420 5:60599644-60599666 AACACCTGGCCCACCCAGGGCGG + Intronic
992250317 5:74869565-74869587 AACACCTGGCCCACCCAGGGCGG + Intergenic
992995514 5:82328777-82328799 AACACCTGGCCCACCCAGGACGG + Intronic
993020236 5:82583443-82583465 AACACCTGGCCCACCCAGGATGG + Intergenic
994419023 5:99509330-99509352 AACACCAGGCCCGCCCAGGGCGG - Intergenic
995711075 5:115036412-115036434 AACACCTGGCCTACCCAGGACGG - Intergenic
995711682 5:115042115-115042137 AACGCCTGGCCCACCCAGGGTGG - Intergenic
996443010 5:123512646-123512668 GACCCCAGCCCCACCCGGGAGGG - Intronic
997210971 5:132076479-132076501 ACCCCCAGGCCTCCCCAGGAAGG - Intergenic
997472031 5:134122534-134122556 ATCCCCAGCCCCTCCAAGGAGGG + Intronic
997718802 5:136061975-136061997 AGCCCCAGCCTCACCCAGGATGG - Intronic
1001575200 5:172758695-172758717 GACCCAGGACCCACCCAGGAGGG + Intergenic
1001708078 5:173756548-173756570 AAGCCCAGTCCCTCCCAGCAGGG + Intergenic
1001933907 5:175691368-175691390 ATCCCCAGACCCATGCAGGAAGG - Intergenic
1002004099 5:176217553-176217575 CACCCCAGACCTACACAGTATGG - Intergenic
1002167897 5:177359424-177359446 AACCCCAGGCCCACCCTGGGAGG + Intronic
1002222275 5:177693087-177693109 CACCCCAGACCTACACAGTATGG + Intergenic
1002947841 6:1779881-1779903 AACACCAGACACAGCCAGGCTGG + Intronic
1003196152 6:3916859-3916881 AACACCTGGCCCACCCAGGGCGG + Intergenic
1004725828 6:18310287-18310309 AACACCTGGCCCACCCAGGGCGG - Intergenic
1005185508 6:23159704-23159726 AACACCTGGCCCACCCAGGGCGG + Intergenic
1005782030 6:29202152-29202174 AACCACAGAACCACCCAAAAGGG - Intergenic
1006050485 6:31339101-31339123 AACACCTGGCCCACCCAGGGCGG - Intronic
1006589182 6:35141572-35141594 AAGCCGAGCCACACCCAGGAGGG + Exonic
1007251584 6:40498954-40498976 ATCCTCAGACACACCCAGAAAGG + Intronic
1007616257 6:43181296-43181318 TACCCCAGAGCCACCGAGGAAGG - Exonic
1007967365 6:46015380-46015402 GACTCCGGACCCTCCCAGGAGGG - Intronic
1008093201 6:47313029-47313051 AACACCTGGCCCACCCAGGGCGG - Intergenic
1008885223 6:56425105-56425127 AACCACAGACTTACCCAGGAGGG + Intergenic
1009955235 6:70445697-70445719 AACACCTGGCCCACCCAGGGTGG - Intronic
1010796025 6:80117608-80117630 AACACCTGGCCCACCCAGGGCGG + Intronic
1013173724 6:107660003-107660025 AGCACCAAACCCACCCAGGCAGG + Exonic
1013255899 6:108385333-108385355 AACACCTGGCCCACCCAGGGCGG + Intronic
1013475049 6:110499317-110499339 AACACCTGGCCCACCCAGGGCGG + Intergenic
1013475731 6:110505703-110505725 AACACCTGGCCCACCCAGGGCGG + Intergenic
1013739738 6:113268330-113268352 AACACCTGGCCCACCCAGGGTGG - Intergenic
1014421998 6:121257811-121257833 TACCCCAGAGCCAACCAGAAGGG - Intronic
1015805946 6:137108691-137108713 AACACCTGACCTACCCAGGGTGG - Intergenic
1016346685 6:143120907-143120929 AACACCTGGCCCACCCAGGGCGG + Intronic
1017016160 6:150101108-150101130 AGCACCAGCCCCACTCAGGATGG - Intergenic
1017835821 6:158176968-158176990 AACACCTGGCCCACCCAGGGCGG - Intronic
1017939832 6:159042073-159042095 CTCCCCAGACCCATCCAGGTAGG - Exonic
1019129364 6:169862477-169862499 AACCCCGGGTACACCCAGGATGG - Intergenic
1019504061 7:1381819-1381841 ACCCCCAGAGGCACCCAGGGAGG + Intergenic
1019613074 7:1946733-1946755 AACCCTAGGCCCAGCCTGGAGGG - Intronic
1020337137 7:7070850-7070872 AACACCTGGCCCACCCAGGGTGG - Intergenic
1021033992 7:15774438-15774460 GACCCCAGACTCAGCCAGTAGGG + Intergenic
1021418355 7:20416533-20416555 AACACCTGGCCCACCCAGGGTGG - Intergenic
1021692970 7:23248031-23248053 AACCCCAAACCCGGGCAGGAAGG - Intronic
1022390372 7:29938560-29938582 AACACCTGGCCCACCCAGGGCGG + Intronic
1023436581 7:40146665-40146687 AACACCTGGCCCACCCAGGGTGG - Intronic
1023878604 7:44306278-44306300 AGTCCCAGACCCTCCCTGGAAGG - Intronic
1024093283 7:45965140-45965162 ACCCCGAGGCCCAGCCAGGAGGG - Intergenic
1024101667 7:46038533-46038555 AACACCTGGCCCACCCAGGGCGG - Intergenic
1024138383 7:46433995-46434017 AACACCTGGCCCACCCAGGGCGG - Intergenic
1024312806 7:47984997-47985019 AACACCTGGCCCACCCAGGGCGG + Intergenic
1024419143 7:49141827-49141849 AACACCTGGCCCACCCAGGGCGG - Intergenic
1024774985 7:52773803-52773825 GACCCCAGACCAACCCAGTCAGG + Intergenic
1024984119 7:55181067-55181089 ATCCCCAGATGCACCCAGGAGGG + Intronic
1025728437 7:64088941-64088963 AACACCTGGCCCACCCAGGGTGG - Intronic
1025809224 7:64863634-64863656 AACACCTGGCCCACCCAGGGTGG + Intergenic
1025816310 7:64915602-64915624 AACACCTGGCCCACCCAGGGCGG - Intronic
1026005107 7:66594159-66594181 AACACCTGGCCCACCCAGGGCGG + Intergenic
1026268099 7:68813009-68813031 AACACCTGGCCCACCCAGGGTGG - Intergenic
1026872263 7:73860328-73860350 AACACCTGGCCCACCCAGGGCGG - Intergenic
1026970198 7:74463009-74463031 AACCCCAGACTCCCACAGGGTGG - Intronic
1028779725 7:94722638-94722660 AACACCTGGCCCACCCAGGGCGG - Intergenic
1028780424 7:94729145-94729167 AACACCTGGCCCACCCAGGGCGG - Intergenic
1032250955 7:130256788-130256810 AGCCCCAGCCCCAGCCAGGAAGG - Intergenic
1032836656 7:135681442-135681464 AACCCCAGACCCACGCCGGAGGG - Exonic
1034356816 7:150457273-150457295 AACACCTGGCCCACCCAGGGCGG - Intronic
1034580582 7:152038452-152038474 AACACCTGACCCACCCAGAGTGG - Intronic
1034581255 7:152044370-152044392 AACACCTGGCCCACCCAGGGTGG - Intronic
1034815878 7:154171502-154171524 AGCCCCCTACCCACCCAGCAGGG - Intronic
1034942331 7:155238539-155238561 AACACCTGGCCCACCCAGGGTGG - Intergenic
1035654479 8:1295380-1295402 AACTCCAGAGCCACCAAGGAGGG - Intergenic
1036675924 8:10833240-10833262 AACCTCAGAGGCACCCAGGGTGG + Intronic
1036821219 8:11941836-11941858 AACACCTGGCCCACCCAGGGTGG - Intergenic
1038718866 8:30015354-30015376 AACACCTGGCCCACCCAGGGAGG + Intergenic
1038733359 8:30147419-30147441 AACACCTGGCCCACCCAGGGCGG - Intronic
1039539613 8:38353137-38353159 AACCCAAGATTCACCCAGGCTGG + Intronic
1040318698 8:46278185-46278207 AACACCTGGCCCACCCAGGGTGG + Intergenic
1040381870 8:46880910-46880932 AACACCTGGCCCACCCAGGGTGG + Intergenic
1040530574 8:48263483-48263505 AACCCCAGAGACACACAGCAGGG - Intergenic
1040608820 8:48962432-48962454 AACACCTGGCCCACCCAGGGTGG + Intergenic
1040645385 8:49391002-49391024 AACACCTGGCCCACCCAGGGCGG + Intergenic
1041018752 8:53617213-53617235 AACACCTGGCCCACCCAGGATGG + Intergenic
1041356240 8:57003631-57003653 AACACCTGACCCACCCAGGGTGG + Intergenic
1042214558 8:66417027-66417049 AACCCCAAACCCACATAAGAAGG - Intergenic
1042222826 8:66490287-66490309 GACCACAGACCCACCAAGTATGG + Intronic
1048060696 8:130916643-130916665 AACACCTGGCCCACCCAGGGCGG + Intronic
1048101530 8:131357587-131357609 AACACCCGGCCCACCCAGGTCGG + Intergenic
1049774999 8:144400073-144400095 CACCCCACAGGCACCCAGGAGGG - Exonic
1050129226 9:2392879-2392901 AACACCTGGCCCACCCAGGGCGG + Intergenic
1052316939 9:27125039-27125061 AACTCAAGACCCAACCAGCATGG + Intronic
1052781455 9:32784592-32784614 AGCCCCACACCCACGGAGGAAGG + Exonic
1052877818 9:33580567-33580589 AACACCAGCCCCATCCATGAGGG + Intergenic
1055452501 9:76443540-76443562 AACACCTGGCCCACCCAGGGTGG - Intronic
1055733784 9:79306488-79306510 AACCCCAGTTCCTCCCAGGGAGG + Intergenic
1055765864 9:79663039-79663061 ACCCCCACCCCCACCCAGGTTGG - Intronic
1056110702 9:83391878-83391900 AGCCTCAGTCTCACCCAGGAGGG + Intronic
1056415909 9:86376120-86376142 AACCCCTGGCCCAACCAGGGTGG + Intergenic
1056915193 9:90740089-90740111 AACACCTGGCCCACCCAGGGCGG - Intergenic
1057904467 9:98973625-98973647 AAACTCAGCCCCACCCAGGCTGG - Intronic
1057928573 9:99173710-99173732 AACCCCACAACAACCCACGAAGG + Intergenic
1058520474 9:105810579-105810601 AACACCTGGCCCACCCAGGGTGG - Intergenic
1059335832 9:113567834-113567856 AACCCCAGACCTACTCTGGTTGG - Intronic
1059350616 9:113662360-113662382 AACCCCACACCCACACAGAGAGG + Intergenic
1059614164 9:115930813-115930835 AACCCAAGACTCATCCAGTAAGG - Intergenic
1060243564 9:121925596-121925618 CCCTCCAGACCCTCCCAGGAAGG + Intronic
1060326507 9:122621264-122621286 AACACCTGGCCCACCCAGGGTGG - Intergenic
1061047847 9:128176869-128176891 ATCCCCAGAACCACCCAGTGAGG + Intronic
1061370707 9:130195938-130195960 GAGCCCAGACCCACCGAGGGAGG + Intronic
1061698114 9:132393380-132393402 AACACCGGGCCCACCCAGGGCGG + Intronic
1061844605 9:133379952-133379974 AACCCCACAGCCAGCCAGCAAGG - Intronic
1062626076 9:137441914-137441936 ACCCCCAGCCCCACCCAGCCCGG - Intergenic
1186095768 X:6100205-6100227 AACACCTGGCCCACCCAGGGCGG - Intronic
1188116043 X:26243933-26243955 AACACCTGGCCCACCCAGGGTGG - Intergenic
1188469963 X:30527479-30527501 AACACCTGGCCCACTCAGGACGG - Intergenic
1188481353 X:30639942-30639964 AACGCCTGGCCCACCCAGGGCGG - Intergenic
1188768143 X:34122297-34122319 AACACCTGGCCCACCCAGGGCGG + Intergenic
1188847417 X:35090311-35090333 AACACCTGGCCCACCCAGGGCGG + Intergenic
1190066297 X:47243870-47243892 AAACCAAGACTCTCCCAGGAGGG - Intronic
1190285974 X:48961735-48961757 GACTCCAGCCCAACCCAGGAAGG + Exonic
1192659403 X:73026612-73026634 ACCACTAGACCCACCCAGGGAGG - Intergenic
1192767634 X:74158660-74158682 AACACCTGGCCCACCCAGGGTGG - Intergenic
1193048528 X:77077782-77077804 AACACCTGGCCCACCCAGGGCGG + Intergenic
1193074497 X:77341145-77341167 AACACCTGGCCCACCCAGGGTGG + Intergenic
1193396376 X:80988602-80988624 AACACCTGGCCCACCCAGGGCGG - Intergenic
1194162218 X:90468072-90468094 AACACCTGGCCCACCCAGGGTGG - Intergenic
1194199469 X:90937184-90937206 CACTTCACACCCACCCAGGATGG - Intergenic
1194355247 X:92874978-92875000 AACACCTGGCCCACCCAGGGCGG - Intergenic
1195546088 X:106114219-106114241 AACACCTGGCCCACCCAGGGAGG - Intergenic
1196778124 X:119359709-119359731 AATCCCAGTCCTCCCCAGGATGG - Intergenic
1197109476 X:122756002-122756024 AACACCTGGCCCACCCAGGGTGG - Intergenic
1197806087 X:130399822-130399844 AACCCCAGAACAAACCATGATGG - Intergenic
1198715054 X:139549671-139549693 AACACCTGGCCCACCCAGGGCGG - Intronic
1198742036 X:139852339-139852361 AACCAGAGACCACCCCAGGAGGG - Intronic
1198944667 X:141996918-141996940 GACCACAAACCCACACAGGAGGG + Intergenic
1199169341 X:144717860-144717882 AACCCCAGTCCTGGCCAGGAGGG - Intergenic
1199700347 X:150371072-150371094 GACCCCCGACCCACCCACCAAGG + Intronic
1200412257 Y:2872505-2872527 AACACCTGGCCCACCCAGGGCGG - Intronic
1200508495 Y:4045809-4045831 AACACCTGGCCCACCCAGGGTGG - Intergenic
1200545462 Y:4513604-4513626 CACTTCACACCCACCCAGGATGG - Intergenic
1200617716 Y:5400277-5400299 AACACCTGGCCCACCCAGGGCGG - Intronic
1200813968 Y:7512763-7512785 AACACCTGGCCCACCCAGGGTGG + Intergenic
1200906190 Y:8485261-8485283 AACACCTGGCCCACCCAGGGTGG - Intergenic
1201370604 Y:13258997-13259019 AACGCCTGGCCCACCCAGGGTGG + Intronic
1201735566 Y:17256885-17256907 AAGCCCAGACCCAGCCACAAAGG + Intergenic
1201892997 Y:18963075-18963097 AACACCTGGCCCACCCAGGGTGG - Intergenic