ID: 923868388

View in Genome Browser
Species Human (GRCh38)
Location 1:237964317-237964339
Sequence TGCCAGCCATCGGGGATGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923868388_923868396 29 Left 923868388 1:237964317-237964339 CCCGACATCCCCGATGGCTGGCA No data
Right 923868396 1:237964369-237964391 TTCAGGAAAGCAGAAGTTACAGG 0: 41
1: 56
2: 88
3: 129
4: 440
923868388_923868394 -1 Left 923868388 1:237964317-237964339 CCCGACATCCCCGATGGCTGGCA No data
Right 923868394 1:237964339-237964361 AAGCAATGGTTTTTATAGTCAGG No data
923868388_923868395 12 Left 923868388 1:237964317-237964339 CCCGACATCCCCGATGGCTGGCA No data
Right 923868395 1:237964352-237964374 TATAGTCAGGAGTAAATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923868388 Original CRISPR TGCCAGCCATCGGGGATGTC GGG (reversed) Intergenic
No off target data available for this crispr