ID: 923868389

View in Genome Browser
Species Human (GRCh38)
Location 1:237964318-237964340
Sequence TTGCCAGCCATCGGGGATGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923868389_923868396 28 Left 923868389 1:237964318-237964340 CCGACATCCCCGATGGCTGGCAA No data
Right 923868396 1:237964369-237964391 TTCAGGAAAGCAGAAGTTACAGG 0: 41
1: 56
2: 88
3: 129
4: 440
923868389_923868394 -2 Left 923868389 1:237964318-237964340 CCGACATCCCCGATGGCTGGCAA No data
Right 923868394 1:237964339-237964361 AAGCAATGGTTTTTATAGTCAGG No data
923868389_923868395 11 Left 923868389 1:237964318-237964340 CCGACATCCCCGATGGCTGGCAA No data
Right 923868395 1:237964352-237964374 TATAGTCAGGAGTAAATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923868389 Original CRISPR TTGCCAGCCATCGGGGATGT CGG (reversed) Intergenic
No off target data available for this crispr