ID: 923868390

View in Genome Browser
Species Human (GRCh38)
Location 1:237964325-237964347
Sequence CCATTGCTTGCCAGCCATCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923868390_923868395 4 Left 923868390 1:237964325-237964347 CCCCGATGGCTGGCAAGCAATGG No data
Right 923868395 1:237964352-237964374 TATAGTCAGGAGTAAATTTCAGG No data
923868390_923868394 -9 Left 923868390 1:237964325-237964347 CCCCGATGGCTGGCAAGCAATGG No data
Right 923868394 1:237964339-237964361 AAGCAATGGTTTTTATAGTCAGG No data
923868390_923868396 21 Left 923868390 1:237964325-237964347 CCCCGATGGCTGGCAAGCAATGG No data
Right 923868396 1:237964369-237964391 TTCAGGAAAGCAGAAGTTACAGG 0: 41
1: 56
2: 88
3: 129
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923868390 Original CRISPR CCATTGCTTGCCAGCCATCG GGG (reversed) Intergenic
No off target data available for this crispr