ID: 923868395

View in Genome Browser
Species Human (GRCh38)
Location 1:237964352-237964374
Sequence TATAGTCAGGAGTAAATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923868390_923868395 4 Left 923868390 1:237964325-237964347 CCCCGATGGCTGGCAAGCAATGG No data
Right 923868395 1:237964352-237964374 TATAGTCAGGAGTAAATTTCAGG No data
923868389_923868395 11 Left 923868389 1:237964318-237964340 CCGACATCCCCGATGGCTGGCAA No data
Right 923868395 1:237964352-237964374 TATAGTCAGGAGTAAATTTCAGG No data
923868392_923868395 3 Left 923868392 1:237964326-237964348 CCCGATGGCTGGCAAGCAATGGT No data
Right 923868395 1:237964352-237964374 TATAGTCAGGAGTAAATTTCAGG No data
923868393_923868395 2 Left 923868393 1:237964327-237964349 CCGATGGCTGGCAAGCAATGGTT No data
Right 923868395 1:237964352-237964374 TATAGTCAGGAGTAAATTTCAGG No data
923868388_923868395 12 Left 923868388 1:237964317-237964339 CCCGACATCCCCGATGGCTGGCA No data
Right 923868395 1:237964352-237964374 TATAGTCAGGAGTAAATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923868395 Original CRISPR TATAGTCAGGAGTAAATTTC AGG Intergenic
No off target data available for this crispr