ID: 923868396

View in Genome Browser
Species Human (GRCh38)
Location 1:237964369-237964391
Sequence TTCAGGAAAGCAGAAGTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 754
Summary {0: 41, 1: 56, 2: 88, 3: 129, 4: 440}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923868388_923868396 29 Left 923868388 1:237964317-237964339 CCCGACATCCCCGATGGCTGGCA No data
Right 923868396 1:237964369-237964391 TTCAGGAAAGCAGAAGTTACAGG 0: 41
1: 56
2: 88
3: 129
4: 440
923868390_923868396 21 Left 923868390 1:237964325-237964347 CCCCGATGGCTGGCAAGCAATGG No data
Right 923868396 1:237964369-237964391 TTCAGGAAAGCAGAAGTTACAGG 0: 41
1: 56
2: 88
3: 129
4: 440
923868393_923868396 19 Left 923868393 1:237964327-237964349 CCGATGGCTGGCAAGCAATGGTT No data
Right 923868396 1:237964369-237964391 TTCAGGAAAGCAGAAGTTACAGG 0: 41
1: 56
2: 88
3: 129
4: 440
923868389_923868396 28 Left 923868389 1:237964318-237964340 CCGACATCCCCGATGGCTGGCAA No data
Right 923868396 1:237964369-237964391 TTCAGGAAAGCAGAAGTTACAGG 0: 41
1: 56
2: 88
3: 129
4: 440
923868392_923868396 20 Left 923868392 1:237964326-237964348 CCCGATGGCTGGCAAGCAATGGT No data
Right 923868396 1:237964369-237964391 TTCAGGAAAGCAGAAGTTACAGG 0: 41
1: 56
2: 88
3: 129
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923868396 Original CRISPR TTCAGGAAAGCAGAAGTTAC AGG Intergenic
900695035 1:4004499-4004521 TTCAGGAAAGCAGAACTCAGTGG - Intergenic
901285588 1:8076093-8076115 TTCAGGAAAGGTGAACTCACAGG - Intergenic
904445092 1:30565722-30565744 TGAAGGAAAGAACAAGTTACAGG - Intergenic
904994031 1:34617056-34617078 TTAAGGAAAGAAGCAGATACGGG + Intergenic
905957013 1:42005667-42005689 TTCAGGAAAGAGTAAGTTGCTGG + Intronic
907114256 1:51955229-51955251 TTCAGGAAAATAGAAGTAATTGG - Intronic
907911602 1:58832265-58832287 TGCAGGAAGGCAGAGGTAACAGG - Intergenic
908252352 1:62274873-62274895 GTCAGGAAGGCTGAAGTTTCGGG + Exonic
908817942 1:68052679-68052701 TTTAGGAAGACAGAAGATACAGG - Intergenic
909221483 1:72967797-72967819 TAAAGAAAAGCAGAAGTTACTGG - Intergenic
909647143 1:77930458-77930480 TACAGGAAAGAATAGGTTACAGG - Intronic
909681441 1:78295796-78295818 TTGAAGAATGCAGAAGTTAGGGG - Intergenic
909861047 1:80606399-80606421 TTAAGGAAGGCAGAACTTAAGGG + Intergenic
910193666 1:84619980-84620002 TTCAGGAGGGCAGGAGTTACAGG + Intergenic
911408156 1:97467477-97467499 TTCAGGAAAGCAGAAGTTACAGG - Intronic
911411619 1:97516476-97516498 TTCAGGAAATCATAAGCTGCAGG + Intronic
911610186 1:99951746-99951768 TTCAGAAAAGCAGAAGTTACAGG - Intergenic
911611134 1:99960207-99960229 TTTAGGGAAGTAGAAGTTACAGG + Intergenic
912023360 1:105137004-105137026 ATCAGAAAAGCAGAAATTATTGG + Intergenic
912400024 1:109382703-109382725 CTCTGGGAAGCAGAAGTAACTGG + Intronic
912541990 1:110423746-110423768 TTCAGAACAGCAGAAGCTACAGG - Intergenic
915643042 1:157244870-157244892 TTTAGGGGAACAGAAGTTACAGG - Intergenic
915666439 1:157449330-157449352 TTTAGGGGAACAGAAGTTACAGG + Intergenic
915846101 1:159266770-159266792 AACAGGAAATGAGAAGTTACAGG - Intergenic
917198916 1:172495376-172495398 TTCAGGGAGGCAGGAGTTAAAGG - Intergenic
917551346 1:176033475-176033497 TGTATGATAGCAGAAGTTACAGG - Intronic
917575473 1:176316783-176316805 TTTAGGAAAGCAGGAGTTACAGG + Intergenic
917576207 1:176324121-176324143 TTTAGGAAATCAGAACTTACAGG + Intergenic
919078316 1:192839136-192839158 TTTAGGGAGACAGAAGTTACAGG + Intergenic
919168102 1:193920237-193920259 TTCAGGGAGGCAGAAGTTACAGG - Intergenic
920823835 1:209405761-209405783 TTCATCAAACCAGAAGTGACAGG - Intergenic
921659928 1:217789572-217789594 TTCAGGAGAGCAGAAGCTACAGG + Intronic
922338921 1:224639964-224639986 GTCAGGAAAACAGAAGTTACAGG - Intronic
922528856 1:226327565-226327587 TTTAGGAAAGCAGAAGTTACAGG + Intergenic
922779074 1:228237057-228237079 TCCAGGAAAGCAGAAAGTCCTGG - Intronic
922971590 1:229746139-229746161 TTCAGAAAAGCAGATGCTAAGGG - Intergenic
923064894 1:230508780-230508802 TTTAGGGAGGCAGAAGTTACAGG + Intergenic
923066359 1:230520882-230520904 TTTAGGGAGACAGAAGTTACAGG + Intergenic
923252412 1:232189824-232189846 TTCAGGAAAGCAGAAGTTACAGG + Intergenic
923437812 1:233984465-233984487 TTTAGGAAAGCAGAAGCCACGGG + Intronic
923817505 1:237397425-237397447 TCTAGGGAAGTAGAAGTTACAGG + Intronic
923868396 1:237964369-237964391 TTCAGGAAAGCAGAAGTTACAGG + Intergenic
923883442 1:238129321-238129343 TTCAGAAAAGCAGAAGTTACAGG + Intergenic
924275834 1:242385949-242385971 TTCTGGAATGCAGAAGTTCAGGG + Intronic
924305102 1:242680030-242680052 TCCAGGAAAGCAGAAGTTACAGG + Intergenic
924827978 1:247562040-247562062 TTCAGGAAAGCAGAATTTACAGG + Intronic
924836178 1:247649780-247649802 TTTAGGGAGACAGAAGTTACAGG + Intergenic
1063196500 10:3748491-3748513 TTCCTGAAAGCAGAAGTGACTGG + Intergenic
1063288653 10:4717336-4717358 GTCAAGGAAGCAAAAGTTACAGG - Intergenic
1063351657 10:5362410-5362432 TCCAGGCTAGCAGAAGTCACTGG + Intergenic
1063782467 10:9341663-9341685 TTCAGGAAACCAGAAAGAACTGG - Intergenic
1064426074 10:15230697-15230719 TTTAGGAAAGAAGCAGTTATGGG + Intronic
1064520274 10:16193623-16193645 TTTTGGGAAACAGAAGTTACAGG - Intergenic
1064864715 10:19866773-19866795 TTTAGAAAAGAAGAACTTACAGG + Intronic
1065008962 10:21404626-21404648 TTTAGGGAGACAGAAGTTACAGG + Intergenic
1065249402 10:23795518-23795540 TTCAGGAAACCAGAAGTTATAGG + Intronic
1065456078 10:25908027-25908049 TTTAGGGAGACAGAAGTTACAGG + Intergenic
1065487358 10:26248151-26248173 TTCAGGAAAGCAGAAGTTACAGG + Intronic
1065801332 10:29355825-29355847 AATAGGAAAGCAGAAGTTATAGG - Intergenic
1065993613 10:31036038-31036060 TTGAGGCTTGCAGAAGTTACTGG - Intergenic
1066089364 10:32002738-32002760 TCCAGGGAAGCAGCAGTTTCAGG - Intergenic
1066335533 10:34473767-34473789 TTTAGGAAAGGAGTAGTAACTGG - Intronic
1066671584 10:37846034-37846056 TTCAGGAAAGCAGAAGTTACAGG - Intronic
1067399455 10:45957574-45957596 TCTAGGAAAGCAGAAGTTATTGG - Intergenic
1067797011 10:49327962-49327984 TTCAGGAAAGCCAAAGTTACAGG + Intergenic
1067867774 10:49926790-49926812 TCTAGGAAAGCAGAAGTTATTGG - Intronic
1068505291 10:57892700-57892722 TTTAGGGAGACAGAAGTTACTGG - Intergenic
1068661795 10:59630190-59630212 TTCAGAAAAGCAGAAGTTACAGG - Intergenic
1069219706 10:65868251-65868273 TTCAGGAAACCAGAAGTTACAGG + Intergenic
1069261426 10:66403137-66403159 GTCAGGAAAGCAGAAGATACAGG - Intronic
1069383688 10:67865111-67865133 TCCAGGAAAGCAGAAGTTAAAGG - Intergenic
1069599359 10:69693464-69693486 TTGAAGATGGCAGAAGTTACAGG + Intergenic
1070094097 10:73319544-73319566 TTCAGGAAAGCAGAAGCTACAGG - Intronic
1070230156 10:74557741-74557763 TTCAGGAAAGTAGAAGTTACAGG + Intronic
1070573132 10:77656652-77656674 TTCATGAAAGCAGAAGTTACAGG + Intergenic
1071032144 10:81197417-81197439 TTTAGGCAGGCAGAAGTTAAAGG - Intergenic
1071036439 10:81252226-81252248 TTTAGGAAGACGGAAGTTACAGG - Intergenic
1071115156 10:82210072-82210094 TTCATGAAATGAGAAGTAACAGG + Intronic
1071187875 10:83064382-83064404 TTTAGGGAGACAGAAGTTACAGG + Intergenic
1071858757 10:89651249-89651271 TTTAGGGAGTCAGAAGTTACAGG + Intergenic
1072015410 10:91341908-91341930 TTCAGGAAAGCAGAAGTTACAGG - Intergenic
1072061817 10:91820412-91820434 TTCAAGAAAGCAGAGTTTGCGGG + Intronic
1072117871 10:92381167-92381189 TTTAAGAAAGCAGAAGTTACAGG + Intergenic
1072264627 10:93715260-93715282 TTCAGGAAAGTAGAAGTTATGGG - Intergenic
1072349471 10:94543366-94543388 TTCAGGAAAGCAGAAATTACAGG + Intronic
1073395697 10:103215564-103215586 TTTAGGAGATCAGAAATTACAGG + Intergenic
1074981810 10:118626056-118626078 TTCAGGAAAGCAGAAATTACAGG + Intergenic
1075852080 10:125597491-125597513 TTCAGGAAAGCAGAAGTTATGGG + Intronic
1075997765 10:126892487-126892509 TTCAGGGAACCAGAAGTTGCAGG + Intergenic
1076365275 10:129917736-129917758 TTCAGTAAAGCAAAAGTATCAGG + Intronic
1076430556 10:130398967-130398989 TTTAGGGAGGCAGAAGTTTCAGG - Intergenic
1076459697 10:130633251-130633273 TTCAGGGAGACAGAAGTTACAGG + Intergenic
1078207992 11:9246895-9246917 TTCAGGAAAGCAGGAGCTGCAGG - Intronic
1078955718 11:16192364-16192386 TTCAGTAAATCTGAAGTCACTGG - Intronic
1080039709 11:27746748-27746770 ATGAGGAAAAAAGAAGTTACTGG + Intergenic
1080305583 11:30831338-30831360 TTCAGGAAAGCAGAGATAAAAGG + Intronic
1080438007 11:32263990-32264012 TTTAGGGAAATAGAAGTTACAGG - Intergenic
1081274681 11:41133950-41133972 TTCAGGAAGGCAGGAGTTACAGG - Intronic
1081322729 11:41711516-41711538 TTCAGGGAAGCAGAAGTAACAGG - Intergenic
1081369538 11:42283280-42283302 ATCAGCAAAGAACAAGTTACTGG - Intergenic
1084081852 11:66832460-66832482 ATCAGGAAAGCAGAAGTACAAGG - Intronic
1084546267 11:69816567-69816589 TTCAGGAAGGGAGAAGTCACCGG + Intronic
1084705622 11:70814593-70814615 TTCAGGAAAACAGAGGCCACTGG + Intronic
1086127561 11:83364933-83364955 TTCTGGAAGGAAGAAGTTACAGG + Intergenic
1086989716 11:93289721-93289743 CTCAGAAAGGCAGAAGTTAGAGG - Intergenic
1087256693 11:95964008-95964030 TTTAGGGATACAGAAGTTACAGG + Intergenic
1087900199 11:103631859-103631881 TTTAGGCAAACACAAGTTACAGG - Intergenic
1088582364 11:111328361-111328383 TTCAGAAAGGCAGAAGTAAAAGG - Intergenic
1088998907 11:115032297-115032319 TTCAGGAAAGTAGAAGTTAAAGG + Intergenic
1089311206 11:117559510-117559532 TTCAGAAAAGCAGGAGTTACAGG - Intronic
1089839984 11:121408046-121408068 TTTAGGGAGACAGAAGTTACAGG - Intergenic
1090534481 11:127625722-127625744 TTCAGGAAAGCAGATGTTACAGG - Intergenic
1090914620 11:131152328-131152350 TTCAGGAAAGCAGAAATTAAAGG + Intergenic
1091880729 12:3975402-3975424 TACAGTACAGCAGAAGGTACTGG + Intergenic
1092756214 12:11765966-11765988 TTCATGAAAGCCGCAGGTACTGG + Intronic
1093159049 12:15723185-15723207 TTCCGGATAGCTGAAGCTACAGG - Intronic
1094212297 12:27905261-27905283 TTCAGGGAGACAGAAGTTACAGG + Intergenic
1094475263 12:30835888-30835910 TTCAGGGGAGCAGAAGGTATGGG - Intergenic
1094527536 12:31242164-31242186 TTCAGGAAAGCAGAAGCTACAGG - Intergenic
1095171231 12:39038480-39038502 TTAGGGAAAGCAGAAGCTACTGG - Intergenic
1095187714 12:39221062-39221084 TTCTGCAATGTAGAAGTTACGGG + Intergenic
1095194989 12:39303835-39303857 TTCAGGAAAGCACAAGGTTACGG - Intronic
1095231142 12:39741646-39741668 TTTAGGGAGGCAGGAGTTACAGG + Intronic
1096576411 12:52555719-52555741 TTCAGCAGAGCAGAAGTTACAGG - Intergenic
1097584930 12:61503920-61503942 TTTAGGGAGACAGAAGTTACAGG - Intergenic
1097654929 12:62346837-62346859 TTCAGCCAAGCTGAATTTACTGG + Intronic
1097750536 12:63347666-63347688 TACAGGAAAGGAGAATCTACAGG - Intergenic
1097825418 12:64170257-64170279 TTCAGTAAAACAGATGCTACAGG + Intergenic
1098297050 12:69014479-69014501 TTTAGGGAAGCAGAAGTTACAGG - Intergenic
1099110246 12:78550916-78550938 GTCAGGGAAGCAGAAATTTCAGG - Intergenic
1100223650 12:92534321-92534343 GTCAAGAAAGCAGAAGATATTGG + Intergenic
1100363551 12:93899122-93899144 TTCAGGAAAGCAGAAGTTACAGG - Intergenic
1101375236 12:104165739-104165761 TTCAGGAAAGCAGAAGTTACAGG + Intergenic
1101920061 12:108925145-108925167 TTTAGGAAAGTAGAAGTTACAGG - Intronic
1102160344 12:110763759-110763781 TTGCAGAAAGCAGAAGTCACCGG + Intergenic
1103878224 12:124145787-124145809 TTTAGGGAGACAGAAGTTACAGG + Intronic
1104314436 12:127683879-127683901 TTCAGGAAAGCAGACAGCACAGG + Intergenic
1106068538 13:26383099-26383121 TTAATGAAAGCAGAGGTTTCTGG - Intronic
1106677524 13:31976694-31976716 TTTAGAAAAGGAGAAATTACAGG - Intergenic
1108167276 13:47706737-47706759 TTCAGGACAGAAGAAATGACAGG - Intergenic
1108206237 13:48093171-48093193 TTCAGGTAAACAGAATTAACAGG + Intronic
1108260222 13:48648413-48648435 TTCAGGGCAGCAGAAACTACAGG + Intergenic
1108364795 13:49698962-49698984 TTCAGGAAAGCATAAATTACAGG - Intergenic
1109471780 13:62816581-62816603 TTTAGGAAGATAGAAGTTACAGG - Intergenic
1109474256 13:62857647-62857669 TTAAGGAAACAAAAAGTTACTGG + Intergenic
1109964765 13:69677802-69677824 TAGAGCAAAGCAGAAATTACTGG + Intergenic
1110518476 13:76445247-76445269 TTCAGGAAATCAGAAGGCATGGG + Intergenic
1110807502 13:79774041-79774063 TTGAGCAATGCAGAAGTTAGGGG + Intergenic
1111564886 13:90001446-90001468 TTTAGGGAGTCAGAAGTTACAGG + Intergenic
1112287589 13:98117854-98117876 TTTAGGAAACCAGAAGTTACAGG + Intergenic
1112693912 13:101926445-101926467 TTCAGGTAAGCAGGTGGTACTGG - Intronic
1112983716 13:105420031-105420053 TTTAAGAAAACAGAATTTACGGG - Intergenic
1113531092 13:111028061-111028083 TTCAGGGAGGCAGGAGGTACAGG + Intergenic
1114229203 14:20765452-20765474 TTCAGGAAAGCAAAAGTTACAGG - Intergenic
1114526209 14:23368206-23368228 TTCTGGAAAGCACAAGTCAGAGG - Intergenic
1114892078 14:26937301-26937323 TTTAGGGAGACAGAAGTTACAGG - Intergenic
1115975578 14:38992958-38992980 TTCAGGAAAGCAGAAATTACAGG - Intergenic
1116325397 14:43527439-43527461 CTCAGGAAATCAGAAGGTAGGGG + Intergenic
1116414448 14:44663592-44663614 TTTATGAAACCAGAAGTTATAGG - Intergenic
1117599654 14:57362250-57362272 TTCAGGAAAGCAGAAGTTACAGG + Intergenic
1118297163 14:64581097-64581119 TTCAGGAAAGCAGAAGTTACAGG + Intronic
1118460802 14:65985429-65985451 TTTAGGAAAGCAGAAGTTATAGG - Intronic
1118464845 14:66021703-66021725 TTTAGGGAGACAGAAGTTACTGG - Intergenic
1118996731 14:70843284-70843306 TTCTGGATTGCAGAAGTCACTGG - Intergenic
1119107053 14:71934320-71934342 TTCAGGAAAGGATGAGTTATTGG - Intronic
1120002634 14:79320217-79320239 TTCATAAAAGCAGAACTCACTGG + Intronic
1120073600 14:80130914-80130936 TGCAGGTAAGCAGTAATTACTGG + Intergenic
1120357826 14:83456966-83456988 TTTAGGAGGGCAGAAGTTATAGG - Intergenic
1120666438 14:87311474-87311496 TAAAGAAAAGCAGAAGTTCCTGG - Intergenic
1120769602 14:88364699-88364721 TTTAGGGAGACAGAAGTTACAGG + Intergenic
1121650123 14:95552051-95552073 TTCAGGAAAGTGGAAGCTACAGG + Intergenic
1122414633 14:101542986-101543008 TTCAGGAATGCAGAGTTAACAGG + Intergenic
1122646627 14:103198627-103198649 TTCAGGGAGGCAGGAGTTACCGG + Intergenic
1122962091 14:105099081-105099103 TCCAGAAAAGGAGAAGTTAAGGG - Intergenic
1123625828 15:22226367-22226389 TTCAGGAAAGCAGTTGTGATTGG - Intergenic
1123767515 15:23496143-23496165 TTCAGGAAAGCAGAAGTAAAAGG + Intergenic
1123780035 15:23617237-23617259 TTCAGGAAAGCAAGGGTTAGGGG - Intronic
1123818751 15:24005293-24005315 TTCAGGAAAGCAGAAGTTTTTGG + Intergenic
1123837876 15:24214302-24214324 TTCAGGAAAGCAGAAGTTACTGG + Intergenic
1123847410 15:24316601-24316623 TTCAGGAAAGCAGAAGTTACTGG + Intergenic
1123866460 15:24523979-24524001 TTCAGGAAAGCAGAAGTTACTGG + Intergenic
1123873385 15:24598642-24598664 TTCAGTAAAGTAGAAGTTACTGG + Intergenic
1124024262 15:25950105-25950127 CCCAGGAAAGCAGGAGTCACAGG - Intergenic
1124074793 15:26434260-26434282 TTCAGGAAAGCAGAAGTTACAGG + Intergenic
1124155336 15:27220152-27220174 TTCAGGAAAGCAGAAGTTACAGG + Intronic
1124179635 15:27460525-27460547 TTCAGGGAAACAGAAGTTACAGG + Intronic
1124322320 15:28724286-28724308 CCCAGGAAAGCAGGAGTCACAGG + Intronic
1124523411 15:30426091-30426113 CCCAGGAAAGCAGGAGTCACAGG + Intergenic
1124535255 15:30540123-30540145 CCCAGGAAAGCAGGAGTCACAGG - Intergenic
1124560836 15:30771749-30771771 ATCAGGTAGGCACAAGTTACGGG + Intronic
1124712161 15:32022638-32022660 GTCAGGAAACCAGAAAGTACTGG + Intergenic
1124763399 15:32467473-32467495 CCCAGGAAAGCAGGAGTCACAGG + Intergenic
1124775227 15:32581574-32581596 CCCAGGAAAGCAGGAGTCACAGG - Intergenic
1125349916 15:38755785-38755807 TTCAGGAATGCAGAAGTTACAGG - Intergenic
1126197240 15:45945780-45945802 TTCCTGGAAGCAGAAGTTTCTGG - Intergenic
1126519948 15:49581709-49581731 TTCAGAAAAGCAAATGTTAAAGG + Intronic
1127384886 15:58459499-58459521 TTCAGGAAACCAGCAGTTTCTGG + Intronic
1127570511 15:60236764-60236786 TTTGGAAAAGCAGAAGTTACAGG - Intergenic
1128200032 15:65797174-65797196 TTCAGGAAATGAGAAATTATAGG - Intronic
1128674839 15:69600888-69600910 TTCAGGTCAGCAGAGGTAACTGG - Intergenic
1129092531 15:73166540-73166562 TTCAGGAAGGTAGAAGTTATAGG + Intronic
1129130417 15:73488545-73488567 TTGAGGAAGGCAGAATTTAAAGG - Intronic
1130771768 15:86931281-86931303 TTCAGGGAAGCGGAAGTTACAGG - Intronic
1131443828 15:92479189-92479211 TTCAGGAAATTAGAACATACAGG + Intronic
1131481235 15:92783504-92783526 TTCAGGAAAGGAGAAGTTACAGG - Intronic
1131599859 15:93836331-93836353 TTTAGGGAAACTGAAGTTACAGG + Intergenic
1131698936 15:94911070-94911092 TTCAAGAAGACAGAAGTCACTGG - Intergenic
1131922148 15:97339823-97339845 TTCAAGAAGGCAGAAGTTACAGG + Intergenic
1132306204 15:100814949-100814971 TTCAGGAAAGCAGAAGTTACAGG - Intergenic
1133420701 16:5644116-5644138 TTCATAAAAGCAGAAGTTCATGG + Intergenic
1134606380 16:15574615-15574637 TTCAGTCAAGCAGAAGTTACAGG + Intronic
1135673219 16:24392397-24392419 TTCAGGAAAGCAGCAATTGCAGG + Intergenic
1135675898 16:24414598-24414620 TTCAGGAAAGCAGAAATTGTAGG + Intergenic
1135979516 16:27136412-27136434 TTCAGGAAAGCAGAAACTACAGG + Intergenic
1136607743 16:31348006-31348028 TTCAGGAAAGCAGAAGTTACAGG - Intergenic
1137254488 16:46763830-46763852 TCCAGAAAATAAGAAGTTACTGG + Intronic
1137365019 16:47852960-47852982 TTCAGGAAAGCAGAAGTTACAGG + Intergenic
1137373257 16:47928463-47928485 TTTAGGAAAATAGAAGTTACAGG - Intergenic
1137773419 16:51036569-51036591 TTGAGGAAAGGAGAAGGTGCTGG - Intergenic
1138031220 16:53560868-53560890 TTTAGGGAGACAGAAGTTACAGG + Intergenic
1138205539 16:55121755-55121777 CTCAGGAAAGGACAAGTCACTGG - Intergenic
1138207738 16:55137214-55137236 TTCAGGAAAACATGACTTACTGG + Intergenic
1138338776 16:56274056-56274078 TTCAGGAAAGCTGAGGTAGCTGG - Intronic
1138339990 16:56282698-56282720 TTTAGGAAAGCAGAAGCTACAGG + Intronic
1138670624 16:58611350-58611372 TCCCGGGAAGCAGAGGTTACAGG + Intronic
1139039075 16:62981667-62981689 TTCAGGATAGGAGAGGATACGGG + Intergenic
1139230426 16:65277774-65277796 TTCAGGATAGGAGAGGATACGGG + Intergenic
1140601863 16:76485889-76485911 TTAAGGAAAGCAGAGGAGACAGG - Intronic
1141914922 16:87089112-87089134 TTTAGGGAGACAGAAGTTACAGG - Intronic
1141923333 16:87151118-87151140 TTTAGGAAAACAGAAAGTACTGG + Intronic
1142502898 17:343214-343236 CTCAGGGAAGCAGAAGATGCAGG + Intronic
1144058566 17:11561626-11561648 TTCTGGAAATCAGGAGTTTCTGG - Exonic
1144151107 17:12447715-12447737 CGCAGGAAAAAAGAAGTTACAGG - Intergenic
1144641489 17:16939721-16939743 CTCAGGGAAGCAGAAGCTGCAGG + Exonic
1145243872 17:21255051-21255073 TTTAGGGAGACAGAAGTTACAGG + Intergenic
1145287579 17:21517812-21517834 TTCAGGAAAGCAGAAGTTACAGG - Intergenic
1145390049 17:22448577-22448599 TTCAGGAAAGCAGAAGTTACAGG + Intergenic
1146592138 17:34136663-34136685 TTTAGGGAGACAGAAGTTACAGG - Intronic
1147236590 17:39062196-39062218 TTCAGGAAAGCAGATGTTACAGG - Intergenic
1147245994 17:39121303-39121325 TTTAGGGAAGCAGAAGTTACCGG - Intronic
1147476275 17:40714597-40714619 TCCAAGAAAGCAGCAGTTCCAGG - Intergenic
1147948961 17:44096369-44096391 CTCATGAAGGCAGAAGATACTGG - Intronic
1148507583 17:48140200-48140222 TTGAGCAATGCAGAGGTTACAGG - Intronic
1149569052 17:57659461-57659483 GTCAGGAAGGCAGAAGTTTGTGG + Intronic
1149880705 17:60287399-60287421 TTCAGGAATATAGAAGCTACAGG - Intronic
1150123307 17:62620710-62620732 TTCAGGATAGCAGAAGCTGCAGG + Intergenic
1150519214 17:65848764-65848786 ATCAGGAATGTAGAAGTTTCTGG - Intronic
1150569714 17:66375150-66375172 TTCAGGTGAGCAGAAGTTCTGGG + Intronic
1151354548 17:73550667-73550689 CTCAAGAAAGCAGAAACTACTGG + Intronic
1151798758 17:76364862-76364884 TTTAGGAAGACAGAAGTTACAGG - Intronic
1152022029 17:77784965-77784987 TTCAGGAAAGCAGAAGTTTCAGG + Intergenic
1152415030 17:80154073-80154095 TTTAGGTAAACAGGAGTTACAGG + Intergenic
1152817141 17:82414821-82414843 TTCAAGAAAACAGAAGCGACAGG + Intronic
1153136075 18:1919038-1919060 TTTAGGAAGACAGGAGTTACAGG - Intergenic
1153531383 18:6050038-6050060 TTCAGGAAGGCAGTAAATACAGG + Intronic
1153903696 18:9641276-9641298 TTCAGGGAAACAGAACTTATAGG + Intergenic
1155342470 18:24826575-24826597 TTCAGGAAAGCAGACATTAGGGG - Intergenic
1155376228 18:25160922-25160944 TTAAGGAGAGCAGAAGTACCAGG + Intronic
1155485971 18:26343252-26343274 TCCAGGGAACCAGAAATTACTGG + Intronic
1156082674 18:33357173-33357195 TTTAGGGGGGCAGAAGTTACAGG - Intronic
1156370243 18:36466452-36466474 TTTAGGAAAGCAGAAGTTACAGG + Intronic
1156394168 18:36682877-36682899 TTCAGAAAAGCACAAGTTATTGG - Intronic
1157549874 18:48574083-48574105 TTCAGGAAAGAAGAGGTGAGGGG - Intronic
1157750903 18:50177547-50177569 TTAAGGAGAGCAGGACTTACAGG - Intronic
1157804560 18:50648609-50648631 TGCAGGAAAGCAAAAGTAAATGG + Intronic
1158093135 18:53738859-53738881 TTTAGGGAGGCAGGAGTTACAGG - Intergenic
1158569213 18:58582704-58582726 TTTAGGGAGACAGAAGTTACAGG + Intronic
1158866209 18:61639819-61639841 TTCAGGGAGGCAGGAGTTACAGG + Intergenic
1158930809 18:62324370-62324392 TTCAAGAAAGCAGAAGTTACAGG - Intergenic
1158985744 18:62815021-62815043 GTCAGGAATGCAGGAGTTTCAGG + Intronic
1159507220 18:69353459-69353481 TTCAGCAAAACAGACGTTAAGGG + Intergenic
1159603508 18:70451570-70451592 TTCAGGGAAGCAGAAGACAAAGG - Intergenic
1159670415 18:71214540-71214562 TTTAGGAGGGCAGAAGTTATAGG + Intergenic
1160263773 18:77320501-77320523 TTCAGAAAAGCAGAAATTACAGG - Intergenic
1160459317 18:79026066-79026088 TTCCTGAAAGCAGAAGTCAGTGG - Intergenic
1160672173 19:370846-370868 TTCGGAAAAGCAAAAGGTACAGG + Intronic
1162175698 19:8828627-8828649 TACAGAAAAGCAGAAGCTACAGG - Intronic
1162708351 19:12572896-12572918 TTCAGGAAAGCAGAGGCTACAGG - Intronic
1164065226 19:21709139-21709161 TTCAGGAGAGCACAATTTAAGGG + Intergenic
1164436356 19:28233335-28233357 TTCAGGAAAGCAGAAGTTGTAGG + Intergenic
1164446221 19:28319627-28319649 TACAGGAAAACAGAAGCCACAGG + Intergenic
1164524445 19:29003127-29003149 TTCAGAAGAGCAGAAGCCACAGG + Intergenic
1164993751 19:32704085-32704107 TTCAAGCAAGCAAAAGTTAGAGG - Intronic
1166409775 19:42548750-42548772 TAAATGAAAGCAGAAGTAACTGG - Intronic
1167700780 19:51043979-51044001 TTTAGGGAGGCAGGAGTTACTGG + Intergenic
925055276 2:852427-852449 TTTAGGGAGGCAGAAGTTACAGG + Intergenic
925268592 2:2585302-2585324 TTTAGGGAAGCAAGAGTTACAGG - Intergenic
925652540 2:6106638-6106660 TTCAGGAAAGCAGAAAAGACAGG - Intergenic
925811148 2:7702173-7702195 TTCAGGAAGGCAGGAGCTACAGG - Intergenic
926374341 2:12211382-12211404 TTCAGGAAAGCAGAAATTACTGG - Intergenic
926456860 2:13077274-13077296 TTCAGGCAAGCACAAGCTATAGG + Intergenic
927217992 2:20680538-20680560 TTCAGTAGAGGAGTAGTTACAGG + Intergenic
928266460 2:29816215-29816237 TTCAGGCAAGCAGGAATAACAGG + Intronic
928483104 2:31703681-31703703 TTCAGGGAAGTAGAAGTTTGGGG - Intergenic
928611696 2:32997855-32997877 TCCAGGAACCCAGCAGTTACTGG + Intronic
928856561 2:35809545-35809567 CTCATCAAAGCAAAAGTTACAGG - Intergenic
929034455 2:37677520-37677542 TGCAGGGAAGCAGAAGTTGGGGG - Intronic
929310199 2:40415367-40415389 TTCAGGAAAATTGTAGTTACAGG - Intronic
929414561 2:41734228-41734250 TTCAGGAAAGCATATATTCCAGG - Intergenic
929502453 2:42502055-42502077 GTCAGGAAGGCAGAGGTTACAGG + Intronic
930285520 2:49422967-49422989 TTCAGGAGGGCAGAAGCTACAGG - Intergenic
930619077 2:53625622-53625644 TTCAGGAAACCAGAAGATGTGGG + Intronic
930858085 2:56040438-56040460 TTCTGGGAACCGGAAGTTACAGG + Intergenic
930893455 2:56418936-56418958 GTCATGAAAACAGAAATTACAGG + Intergenic
931121301 2:59223216-59223238 TACAGGAAGGCATAAGTTAGAGG + Intergenic
931397434 2:61900197-61900219 TTCAGGGAGGCAGGAGTTACAGG + Intronic
931753732 2:65353208-65353230 TGCAGGACAGCAGTACTTACTGG - Intronic
932218692 2:69983756-69983778 ATAAGGGAAGCAGAAGTTGCTGG - Intergenic
932922292 2:75930193-75930215 TTCAGGAAAACACAGGTTTCTGG - Intergenic
932959643 2:76397750-76397772 TTCAGGAAAGCAGAAGTTACAGG - Intergenic
932988412 2:76756363-76756385 TTTAGGGAAGCAAACGTTACAGG - Intronic
933345815 2:81084348-81084370 TCCAGGAAGGCAGAGGTTTCAGG + Intergenic
933388989 2:81647688-81647710 TTTAGGGAGACAGAAGTTACAGG + Intergenic
933451836 2:82463695-82463717 TTCAGGAAAGCAGAAGTTACAGG - Intergenic
933481628 2:82864765-82864787 TTCATGACAGCATAAATTACTGG + Intergenic
934162921 2:89269460-89269482 TTCAGGAAAGCAGAAGTTACAGG + Intergenic
934166715 2:89300610-89300632 TTCAGGGAATCAAAAGTTACAGG + Intergenic
934200566 2:89881847-89881869 TTCAGGGAATCAAAAGTTACAGG - Intergenic
934204352 2:89913064-89913086 TTCAGGAAAGCAGAAGTTACAGG - Intergenic
934632061 2:95937480-95937502 TTCAGAAAAGCACAAAATACAGG + Intronic
934801442 2:97165741-97165763 TTCAGAAAAGCACAAAATACAGG - Intronic
935122264 2:100193291-100193313 TTCAGGAAAGCAGAAGTTATGGG + Intergenic
935162606 2:100542268-100542290 TTCAGGAAAGCAGAAGTTACAGG + Intergenic
935304511 2:101723975-101723997 TTTACTAGAGCAGAAGTTACAGG - Intronic
935316834 2:101843130-101843152 TTCAGTAAAGCAGAAGGTTAAGG + Intronic
935975096 2:108570497-108570519 TTCTGGAATCCAGAAGTTGCTGG + Intronic
936366709 2:111863765-111863787 TTCTGGAAAGGTGAAGTCACAGG + Exonic
936573381 2:113634473-113634495 TTCAGGAAAGGAGAAGTCAGGGG + Intronic
936771509 2:115919390-115919412 TTTTGGGAAACAGAAGTTACAGG + Intergenic
937053622 2:118912691-118912713 TTTCAGAAAGCAGAAGTTACAGG + Intergenic
937683143 2:124666146-124666168 TTTAGGGAGACAGAAGTTACAGG + Intronic
937899322 2:127005591-127005613 TTCAGGAAGGCAAAAGTTACAGG - Intergenic
937900842 2:127017844-127017866 TTCAGGAAAACGGAAGCTACAGG + Intergenic
938149268 2:128868020-128868042 CTCAAGAAAGCAGAAGTCAAAGG - Intergenic
938260287 2:129891074-129891096 TGCAGGAAAGCAGAAGCTACAGG - Intergenic
938998558 2:136707038-136707060 TTCAGGTATTTAGAAGTTACAGG + Intergenic
940704199 2:157083407-157083429 TTTAGGGAGACAGAAGTTACAGG - Intergenic
940906309 2:159172988-159173010 ATCCGGAAAGCAGAAGGGACGGG - Intronic
941575351 2:167223183-167223205 TTGAGGAAAGAAGAAGCTTCTGG - Intronic
941692085 2:168511198-168511220 ATCATGAAAGGAGAAGGTACAGG - Intronic
941991188 2:171559214-171559236 TTTAGGGAAGCAGGAGTTATAGG + Intergenic
942105299 2:172628164-172628186 TTCAGGAAAGCAGAAGCTATAGG - Intergenic
942401616 2:175609215-175609237 TTCAGGCAGGCAGAAGTTTCAGG + Intergenic
942598154 2:177612127-177612149 TTTAGGAAAGCAGATGTTACAGG + Intergenic
942625394 2:177894942-177894964 TTTAGGGAGGCAGGAGTTACAGG - Intronic
942668718 2:178350750-178350772 TTCCCCAAAGTAGAAGTTACTGG - Intronic
943453404 2:188073568-188073590 TTCAGGAAAGCAAATGCTAAGGG - Intergenic
943959481 2:194243582-194243604 TTCATGAAAGTAAAAGTTACTGG + Intergenic
944200967 2:197106820-197106842 TTCAGGAAAACATAACTTAGTGG + Intronic
944389788 2:199206073-199206095 TTCAGGAATGAAAAAGATACAGG - Intergenic
945529465 2:210932469-210932491 TTCAGGGAGACAGGAGTTACAGG + Intergenic
946089838 2:217211245-217211267 TTTAGGGAGACAGAAGTTACAGG - Intergenic
946092330 2:217239357-217239379 TTCAGGACACTAAAAGTTACAGG - Intergenic
946330629 2:219006971-219006993 CTCAGGAAACCAGAATTTCCTGG - Intronic
946344025 2:219093647-219093669 AACAGGAAAGGAGAAGTGACTGG + Intronic
946471241 2:219963304-219963326 TTCAGGGAAGCGGAAGTTACAGG - Intergenic
946946150 2:224824890-224824912 ATCATGAAGGCTGAAGTTACAGG + Intronic
947226078 2:227841594-227841616 TTCAGGGAGACAGAAGTTACAGG + Intergenic
947618008 2:231570620-231570642 TTTAGGAGGACAGAAGTTACAGG + Intergenic
948365965 2:237454951-237454973 TTCAGGAAAGCAGAAATTACAGG - Intergenic
948442076 2:237999436-237999458 TTCAGGTAAGCAAAAATTTCTGG - Intronic
948843333 2:240670630-240670652 TTTAGGAGGGCAGAAGTTACAGG - Intergenic
1169302876 20:4459894-4459916 TTTAGGGAGACAGAAGTTACAGG - Intergenic
1169430490 20:5531873-5531895 TCCAGGAAAGCAGCAATGACTGG + Intergenic
1170145330 20:13167558-13167580 CTCAGGAAAGCAGAAGATAAAGG + Exonic
1170191814 20:13652096-13652118 TTCAGGAAAGCAGAAGTTACAGG + Intergenic
1170467875 20:16639320-16639342 TTCAGGAAAGCAGAAGTTACAGG + Intergenic
1171494479 20:25546059-25546081 TTTAGGGAAGCAGAAGTCACAGG - Intronic
1173186588 20:40844879-40844901 TTCTGGGAACCAGAAGGTACAGG - Intergenic
1173377404 20:42498918-42498940 TTTAGGAAGACAGAAGTTACAGG - Intronic
1174944908 20:54974302-54974324 TTCAGGAAAGGAGAAGCTACAGG + Intergenic
1175155346 20:56967639-56967661 TTCAGGGAAGCAGAGGCTCCAGG - Intergenic
1175635388 20:60578563-60578585 TTTAGGGGGGCAGAAGTTACAGG + Intergenic
1175753326 20:61514054-61514076 CTCAGGAAGGCAGAAGCTACAGG + Intronic
1176251629 20:64124408-64124430 TTCAGAGAGGCAGGAGTTACAGG + Intergenic
1176291542 21:5047998-5048020 TTCAGGAAGACACAAGTTACAGG - Intergenic
1177007553 21:15692553-15692575 TTCAGGAGAGCAGAGGTTACAGG + Intergenic
1177020574 21:15851634-15851656 TTAAGGAAAACAAAAGTTAAGGG - Intronic
1177326226 21:19592662-19592684 TTCTGGAAATCAAATGTTACTGG + Intergenic
1177385906 21:20409139-20409161 TTTAGGGAGGCAGAAGTTACAGG - Intergenic
1177416069 21:20794848-20794870 TTTAGGAAAGCAGAAGCTACAGG - Intergenic
1177825084 21:26073955-26073977 TTCAAGAAAGCAAGAGCTACAGG + Intronic
1178134894 21:29615851-29615873 TGCAGGAAATCCAAAGTTACGGG - Intronic
1179297464 21:40076254-40076276 TTCAGGAAAGAGGCACTTACAGG + Intronic
1179653711 21:42832104-42832126 TTCAGAAAACCAGAAGTTTTGGG - Intergenic
1179865713 21:44215643-44215665 TTCAGGAAGACACAAGTTACAGG + Intergenic
1181836970 22:25618745-25618767 TTCAGGGATGCAGAGGTTCCTGG - Intronic
1182460063 22:30477220-30477242 TTCAGGAGAGCAGAAGTTATAGG - Intergenic
1182698280 22:32210946-32210968 TTCAGGAAAAGAGAAGCTAAAGG - Intergenic
1185076352 22:48685022-48685044 TTTAGGGACACAGAAGTTACAGG + Intronic
1185134463 22:49061647-49061669 TTCAGTAAAGCTGAAGGGACAGG + Intergenic
1185426801 22:50776407-50776429 TTCAGGAAAGGAGAAGTCAGGGG - Intronic
949165140 3:931286-931308 TGCAGGAGAGCAGGAGTTGCTGG - Intergenic
949198570 3:1343268-1343290 TTTAGGAAGTCAAAAGTTACAGG + Intronic
949605003 3:5643300-5643322 CTAAGAAAAGCAGAAGTTACAGG + Intergenic
949823425 3:8139459-8139481 TTCAGGAAAGCACAAATTACAGG + Intergenic
950321522 3:12059235-12059257 TTCAGGAAAGCAGAAGTACAAGG + Intronic
950673951 3:14543594-14543616 TTCAGGGAAGCAGAAGAAAAGGG + Intergenic
950920578 3:16690050-16690072 TTTAGGGAGGCAGAAATTACAGG + Intergenic
951274878 3:20672873-20672895 TTCAGGAAAGCAGAAGTCTCAGG - Intergenic
951472137 3:23067981-23068003 TTCAGAAAAGTAGAAGTTACTGG + Intergenic
951788284 3:26449244-26449266 GTTAAGAAAGCAGAAGTTATAGG - Intergenic
952665973 3:35904877-35904899 TTTAGGAGAACAGAAGTTACAGG + Intergenic
952771184 3:37002454-37002476 TTCTGGAGATCAGAAGATACGGG + Intronic
952908563 3:38163570-38163592 TTCGGAAAAGAAGAAGTTACAGG + Intergenic
953009499 3:39011197-39011219 TTCAGGAAAGTAGAAGTTACAGG + Intergenic
953178080 3:40570168-40570190 TTTAGGGAGACAGAAGTTACAGG + Intronic
953226897 3:41029528-41029550 TTCAGGGAAGCACAACTCACTGG - Intergenic
953378159 3:42446125-42446147 TTTAGGGAGACAGAAGTTACAGG + Intergenic
955343364 3:58142731-58142753 GTCAGGAAAGGAGAAATCACTGG + Exonic
955378224 3:58415824-58415846 TTCAGGAAAACAGAAGCTACAGG + Intronic
956244581 3:67167943-67167965 TTAAGAAAAGCAGAACTTAAAGG - Intergenic
956401022 3:68879982-68880004 TTCAGGAAAACACAATTTGCTGG + Intronic
956880532 3:73506716-73506738 TTAAGGAAAACATAAGTTAATGG + Intronic
956970446 3:74517237-74517259 TTCAGAAAAGCAGAAGTTAAAGG - Intronic
957579888 3:82058184-82058206 TTGAGGAAATCAGGAGATACTGG + Intergenic
959126184 3:102292783-102292805 TTCAGAAAAACATAACTTACTGG - Intronic
959156008 3:102666778-102666800 TCCAGGAGAGCAGAAGTTGTAGG - Intergenic
959573402 3:107909305-107909327 TTCAGGACAGCGGATGTTATAGG + Intergenic
959582795 3:107999390-107999412 TTCAGAAAAGCAAAAGTCACAGG + Intergenic
959715923 3:109432469-109432491 TTCAGAAAAGCAGAAGTTATAGG + Intergenic
959959924 3:112286613-112286635 TTAAGGAAAGTAGAAGTAATAGG - Intronic
960007118 3:112791521-112791543 TTAAGAAAATCAGAAGTTTCGGG + Intronic
961470927 3:127111734-127111756 TTTAGGAGAACAGAAGTTACAGG - Intergenic
961633512 3:128318500-128318522 CCCAGGACAGCAGAAGGTACAGG + Intronic
961988649 3:131164117-131164139 TTAAAGAAAGCAAATGTTACGGG - Intronic
961999303 3:131278499-131278521 TTCCTGAGAGCAGAAGTTTCAGG - Intronic
962094935 3:132283943-132283965 TTCAGGGAAGTAGAAGTTACAGG + Intronic
964278671 3:155037476-155037498 AGCAGGAGAGCAGAAGTTAGAGG - Intronic
964304573 3:155326469-155326491 TTCAAGAAAGCAGAAGTCATAGG + Intergenic
964741881 3:159975048-159975070 TCTAGGAAAGAAGGAGTTACTGG + Intergenic
965001084 3:162954283-162954305 GTCAGGAAAGGAGGAGTTGCAGG - Intergenic
965871125 3:173266653-173266675 TTTAAGAAAGCGGAAGTTACAGG + Intergenic
966962387 3:184953277-184953299 TTCAGGAAAGCAGAAATTACAGG + Intronic
967237334 3:187398623-187398645 TTCAGGAGAATAGAAGCTACTGG - Intergenic
967382502 3:188874735-188874757 TACAGGAATGCAGAAGTGAATGG - Exonic
967648949 3:191961935-191961957 TGCAGGGAGGCAGGAGTTACAGG - Intergenic
969215205 4:5716247-5716269 TTCAGGAAAGCAGAAGTTACAGG + Intronic
970276116 4:14403083-14403105 TTTAGGGAGACAGAAGTTACAGG + Intergenic
971475474 4:27068051-27068073 CCCAGGAAAGCAGATGCTACTGG - Intergenic
972085791 4:35213274-35213296 TTCTGGTCAGCAGATGTTACTGG - Intergenic
973073446 4:45894277-45894299 TTCAGGAAAGCAGAAGCTACAGG + Intergenic
973562394 4:52150143-52150165 TTCAGGAAAGCAGAAGCTAGAGG + Intergenic
973816260 4:54622293-54622315 TTCAGAAAAGCAAAAGTAACAGG - Intergenic
974897998 4:67962505-67962527 TTGAGGAAAACAGAAGTTAGGGG - Intronic
974923054 4:68265967-68265989 TTTAGGGAGGCAGGAGTTACAGG + Intergenic
975209162 4:71678901-71678923 ATGAGTAAAGCAGATGTTACAGG - Intergenic
976284188 4:83355465-83355487 TTCAGGAAAGCAGAAGTTATAGG + Intergenic
976556961 4:86461261-86461283 TTGAGGAGGACAGAAGTTACAGG + Intronic
976701070 4:87968956-87968978 ATCAGGTAAACAGAAGTGACCGG + Intergenic
977386548 4:96347462-96347484 TTCAGGAAAGCAGAAGTTACAGG + Intergenic
978840822 4:113209679-113209701 TTTCAGAAAGCAGAAGTTACAGG + Intronic
979374243 4:119926293-119926315 TTTAGGAAATCAGAAGTTTTGGG + Intergenic
979918228 4:126466489-126466511 TTCCTGAAAGCAGAAGACACAGG + Intergenic
979978868 4:127230158-127230180 TTCAGGAAAGAAGAGATGACTGG - Intergenic
980221572 4:129923815-129923837 TTGAGGAACTCAGAATTTACAGG + Intergenic
980318143 4:131232896-131232918 TTCAGGAAATCAGGGGTTATAGG + Intergenic
980329791 4:131395842-131395864 TTCAGGGAGTCAGAAGTTACAGG - Intergenic
980487355 4:133475954-133475976 GTCCTGAAAACAGAAGTTACAGG + Intergenic
980829032 4:138107284-138107306 TTCAGGAAATAAGAAGAGACTGG - Intergenic
980983538 4:139673875-139673897 TTCAGGAAAGCAGAAGGTATAGG + Intronic
981171265 4:141625851-141625873 TTTAGGGAGACAGAAGTTACAGG - Intergenic
981692270 4:147522878-147522900 TTTAGGGAGACAGAAGTTACAGG + Intronic
982263874 4:153520688-153520710 TTAAGGAAAGAAGAAGAGACAGG - Intronic
982787885 4:159557648-159557670 TTTAGGGAGACAGAAGTTACAGG + Intergenic
982890937 4:160849202-160849224 TTCCAGAAGGCAGAAATTACAGG + Intergenic
982990797 4:162271367-162271389 TCTGGGAAAGCAGAAGTTACGGG - Intergenic
983495516 4:168438319-168438341 TTCAGGGAGGCAGGAGTTACAGG - Intronic
983810034 4:172050328-172050350 TTCAGGAAGGCAGAAGTTACAGG + Intronic
984245639 4:177272364-177272386 TTCAGGAAAGCAGAAGTTATAGG - Intergenic
984510144 4:180669185-180669207 TTCAGGAAATCAGCACTTACTGG + Intergenic
984561698 4:181278440-181278462 TTTAGGAAAGGTGAAGTTAGAGG - Intergenic
984706577 4:182851474-182851496 TTCAGGAAAGCAGAAGTTACAGG + Intergenic
985608669 5:873559-873581 CTCAGGAAAGCAGAACTGAAAGG - Intronic
985625994 5:988112-988134 TTCAGGTAAGCAGAAACCACCGG - Intergenic
985659288 5:1148027-1148049 TTCAGGGAGACAGAAGTTACAGG - Intergenic
985976760 5:3425388-3425410 TCTAGGAAAGCATAAGTTATTGG + Intergenic
986089312 5:4488381-4488403 TTCAAGAAAGTAGAAATTACAGG + Intergenic
986145874 5:5077210-5077232 TTTAGGGAGGCAGAAGTTACAGG + Intergenic
987432733 5:17856413-17856435 TTCAGCAAAGCAGAAGTTACAGG + Intergenic
988191043 5:27935174-27935196 TTCAGGGCAGCAGAAATTGCAGG - Intergenic
988238183 5:28574227-28574249 TTCAGGAAAACAGAAGTTACAGG + Intergenic
988663320 5:33297694-33297716 GGCAGGAAGGCAGAAGTTACAGG - Intergenic
989477539 5:41891409-41891431 TTTAGGGAGACAGAAGTTACAGG - Intergenic
989541998 5:42628454-42628476 TTCAGGGAGGCAGGAATTACAGG + Intronic
989737739 5:44729321-44729343 TTCAGGAAAACACAAGCTACAGG + Intergenic
990724276 5:58736128-58736150 TGCAGGAAAGCAGGAGGGACAGG - Intronic
990741727 5:58919383-58919405 TTCAAGAAAGTAGAAGTAACAGG - Intergenic
991174364 5:63669257-63669279 TTCAGTAAAGCAGATGCTAACGG + Intergenic
992244968 5:74811394-74811416 TTCAGTAAAGCAGTAATTAGGGG + Intronic
992721891 5:79569206-79569228 TTCAGGGAGGCAGGAGTTATAGG + Intergenic
992732391 5:79685244-79685266 TTCAGGACAGCAGCTCTTACAGG - Exonic
993636712 5:90353072-90353094 TTCAGGAAAACAGAAGTAATAGG + Intergenic
993849112 5:92983782-92983804 TTAAGCAGAGCAGAAGCTACTGG + Intergenic
994792628 5:104249650-104249672 TTTAGAAAAGCAGGAGTTATAGG + Intergenic
995109370 5:108411880-108411902 TTCAAGAAAGCAGAAATTATAGG + Intergenic
995364850 5:111346991-111347013 TTCAGGAAAGCAGAAGTAACAGG + Intronic
995399781 5:111727940-111727962 TTCAGGAAGCCAGAAGTTATGGG + Intronic
995600398 5:113789735-113789757 TTCAGCAAAGCAGTAGGAACTGG - Intergenic
995611014 5:113910360-113910382 TGCAGGAAAGCAAAAATTACAGG - Intergenic
996630103 5:125620682-125620704 TTGAGCAAAGCCAAAGTTACAGG - Intergenic
996842732 5:127865501-127865523 TTCAGGAAAGCTGAAGGGAGAGG + Intergenic
996891616 5:128427722-128427744 GGCAGGAAAGCAGAAGTTACAGG - Intronic
997079202 5:130718055-130718077 TTCAGGAAAGCCAAAGTTACAGG + Intergenic
997425024 5:133797173-133797195 TTTAGGGAGGCAGGAGTTACAGG + Intergenic
997458732 5:134037668-134037690 TTCAGGAAAGGAGAAGTCACAGG - Intergenic
997537774 5:134635924-134635946 TTCAGAAAAGCAGAAGTTACAGG - Intronic
998362779 5:141604154-141604176 TTCTGAACAGCAGAAGATACCGG - Intronic
998664138 5:144276565-144276587 TTCAGTAAACCACAAGTTAGTGG - Intronic
998667948 5:144320172-144320194 TGCAGGAAATTAGAAGCTACTGG - Intronic
998758638 5:145407645-145407667 TTCAAGAGAGCAGCAGCTACAGG - Intergenic
999028396 5:148261551-148261573 TTTAGGAAAGTAGAAGTTACAGG - Intergenic
999202734 5:149827800-149827822 GTCTGGAACTCAGAAGTTACTGG + Intronic
999289902 5:150417631-150417653 CTGAGGAAAGCAGAAGTTATAGG - Intergenic
999524535 5:152389724-152389746 TTCATGAAAGTAGAAGTCATTGG - Intergenic
999896184 5:156036333-156036355 TTCAGGAAAGCAGAAGTTTCAGG + Intronic
1000026301 5:157362001-157362023 TTCAGGAAAGCAGAAGTTTCAGG + Intronic
1000185733 5:158856051-158856073 TTAAGAAAAGAAGAAGCTACAGG + Intronic
1000229394 5:159300802-159300824 TTCTGGAAAGCAGAAGTTATAGG - Intergenic
1000261637 5:159594003-159594025 TTCAAGAAAGTAGAAGTTACAGG - Intergenic
1002261939 5:177999332-177999354 TTCAGGAAATCAGAGGGTCCTGG - Intergenic
1002930338 6:1630010-1630032 TTCAGGAAAGGAGAACTTAATGG + Intronic
1003118242 6:3297711-3297733 CTCAGGAAAGCTGAGGTCACAGG + Intronic
1003304742 6:4916088-4916110 TTTAGGAATACAGAAGTTATGGG - Intronic
1004106787 6:12673399-12673421 TTTTGAAAAGCAGAAGTCACTGG - Intergenic
1004293457 6:14389130-14389152 TTCAGGAAAGCAGAAGTTACAGG - Intergenic
1004475092 6:15964209-15964231 TTCAGGAAAGCAGAAGTTACAGG + Intergenic
1005048171 6:21661724-21661746 TTCAGAAAAGCAGAGGTGAAAGG + Intergenic
1005118254 6:22362201-22362223 TTAAGCAAGGCAGAAGTTAGAGG + Intergenic
1005643177 6:27816016-27816038 TTTAGGGAAGCAGAAGTTATAGG + Intergenic
1007285008 6:40741309-40741331 TTCAGGCAAGCAGAAATTTCTGG + Intergenic
1008097965 6:47359493-47359515 TTGGGAAAAACAGAAGTTACTGG - Intergenic
1008386750 6:50900516-50900538 ATCTGGAAAGCAGAAGTAAATGG - Intergenic
1008886340 6:56434646-56434668 ATTATGAAAGCAGAAGTTAATGG - Intergenic
1009524857 6:64730943-64730965 AACAGGAAAGCAGAAGTAAATGG - Intronic
1009901439 6:69812168-69812190 TTCAGGAAAGCAGAAGTTATAGG + Intergenic
1010083717 6:71891466-71891488 AGGAGGAAAGCTGAAGTTACAGG - Intronic
1010304420 6:74302208-74302230 TTTAGGGAGACAGAAGTTACAGG - Intergenic
1010433970 6:75809551-75809573 TTTAGGAAGGCAGGAATTACAGG + Intronic
1010541789 6:77100270-77100292 ATGAGGAAAATAGAAGTTACTGG - Intergenic
1010620009 6:78062458-78062480 TCCAGCAAAGCAGCACTTACGGG - Intergenic
1010767639 6:79794549-79794571 TTCAGGATAGCATAACTTTCAGG + Intergenic
1011389501 6:86836493-86836515 TTCAGGAAAGGAGGAATTATAGG - Intergenic
1011488382 6:87866728-87866750 TACAAGAAAGCAGAAGGTACAGG + Intergenic
1012229622 6:96745565-96745587 TTCAGGAAAGCAAGGGTTACAGG + Intergenic
1012246060 6:96926795-96926817 TTAAGGAAAACAGAAGCTTCTGG + Intronic
1012347301 6:98206606-98206628 TTCTGCAAAACAGAAGTTACAGG + Intergenic
1014177803 6:118349271-118349293 TTCTGGGAGGCAGAATTTACAGG + Intergenic
1014241994 6:119028059-119028081 TTCAAGAAAGCAGAAGCTACAGG - Intronic
1014249178 6:119098478-119098500 TTCAGCAAAGCAGAAATTACAGG + Intronic
1014298311 6:119648365-119648387 TTCAGGAAAGTAATACTTACGGG + Intergenic
1014781487 6:125570205-125570227 TTCAGGAAAGCAGAAGTACCAGG - Intergenic
1015106909 6:129547623-129547645 TTAAGGAAAGCAGAAGTTAAAGG + Intergenic
1015315570 6:131812722-131812744 TTCAGGGAGGCAGGAGTTACTGG + Intronic
1015411489 6:132898506-132898528 TTCAGGAAGGCAGATTTTCCTGG - Intergenic
1015905823 6:138115441-138115463 GTAAGGCAAGCAGAAGTGACAGG - Intergenic
1016293847 6:142552807-142552829 TTTAGGGAGACAGAAGTTACAGG - Intergenic
1016363813 6:143294663-143294685 TTCAGCAAAGGAGAAGTCACTGG - Intronic
1016680941 6:146828714-146828736 TTCAGGAAAGCAGAAACTATAGG - Intergenic
1016831743 6:148440940-148440962 TCCATGAGAGCAGAAATTACAGG - Intronic
1017868481 6:158465736-158465758 TTCAGGGAGGCAAGAGTTACAGG + Intronic
1018012247 6:159681718-159681740 TTCAGGAAAGCAGAAGTTAAAGG - Exonic
1018018464 6:159733980-159734002 TTGAAGAAAGCAGAATTTAGAGG - Intronic
1018287591 6:162257490-162257512 TTCAGGAAAACACAGGCTACTGG + Intronic
1018656359 6:166040895-166040917 TTCAGGAAGGCGGAAGCTACAGG - Intergenic
1018697100 6:166398767-166398789 CTCAGGAAAGCTCAAGTCACAGG - Intergenic
1019265200 7:111322-111344 TCCAGGAAAGGCAAAGTTACAGG - Intergenic
1019269404 7:138573-138595 TTCAGGGAGGCAGGAGTTACAGG + Intergenic
1019824216 7:3270108-3270130 TGCAGGAAATCAGAAGTTGGTGG - Intergenic
1020764906 7:12307285-12307307 TTCAGGAGAGCAGAAGTAATAGG - Intergenic
1020952814 7:14702502-14702524 TTCAGGAAAGCAGATGACAGAGG + Intronic
1021124693 7:16837704-16837726 TTCAGTATAGCAGCATTTACAGG - Intergenic
1021332145 7:19351593-19351615 ATGAGGAAAGCAGAAGGTCCTGG + Intergenic
1021670923 7:23033974-23033996 TTCAGGAAACCAGAAGTTATAGG + Intergenic
1021688773 7:23212414-23212436 GTCAGGAAAACAGAAGCTACAGG - Intergenic
1022511880 7:30940867-30940889 TTGAGGAAAGCAAAAGTTTAAGG - Intronic
1022616555 7:31936916-31936938 TTTAGGGAGACAGAAGTTACAGG + Intronic
1022981898 7:35611933-35611955 GACAGGAAGGCAGAGGTTACAGG + Intergenic
1023485458 7:40681637-40681659 TTCAGGAAAGCAGAAGTTACAGG + Intronic
1024198762 7:47085951-47085973 TGCAGGCAAGCAGAATTCACAGG - Intergenic
1024321755 7:48078043-48078065 TTCAGGAAAGCACACGCTACAGG - Intergenic
1024325677 7:48107544-48107566 TCCAGGAGAGCAGAAGTGAAGGG - Intronic
1024383718 7:48727125-48727147 TTCAGGAAGGCAGGAGTTATAGG - Intergenic
1024716445 7:52085150-52085172 TTTAGGAGAAAAGAAGTTACAGG + Intergenic
1024999337 7:55301822-55301844 TTCAAGGAAGCAGGAGTTATAGG + Intergenic
1025033571 7:55576358-55576380 TTTAGGAGAACAGAAGTTACAGG + Intergenic
1025101119 7:56136035-56136057 TTCAGGAAAGTAGAAGTTGCAGG + Intergenic
1025140529 7:56459785-56459807 GTCTGGGAAGCAGAAGTTGCAGG + Intergenic
1025773887 7:64541180-64541202 TTCAGGCAAACAGGAATTACAGG - Intronic
1026119025 7:67520498-67520520 TTTAGGAAAGTAGAAGCTACAGG + Intergenic
1026212921 7:68322881-68322903 TTCAGGAAAACAGAAGTTACAGG + Intergenic
1026264423 7:68783776-68783798 TAAAGGGAGGCAGAAGTTACAGG - Intergenic
1026290344 7:69000513-69000535 TTTAGGGAGACAGAAGTTACAGG - Intergenic
1026302140 7:69107267-69107289 TTTAGGGAGACAGAAGTTACAGG - Intergenic
1026318228 7:69246030-69246052 TTCAGGAAAGTAGAAATTACAGG - Intergenic
1026336327 7:69397075-69397097 TTCAGGAAAACAAAAGAAACTGG + Intergenic
1026346883 7:69482221-69482243 TCCAAGAAAGCAGAAGCTACAGG - Intergenic
1026521579 7:71122701-71122723 TTCAGGAAAGCAGAAGCTACAGG - Intergenic
1026901837 7:74041596-74041618 TTCAGGAAGGCTGAAGTGAGAGG + Intronic
1028019496 7:85751975-85751997 TTCAGAAAAGCAAATGTTAAGGG + Intergenic
1028045354 7:86110635-86110657 TTCAGGAAAACAGAAGTTACAGG - Intergenic
1028077929 7:86537576-86537598 TTTAGGAAAGCAGAAGTTACAGG + Intergenic
1028130458 7:87166076-87166098 ATGAGGAAAGCAGAAATGACTGG - Intronic
1028871930 7:95779884-95779906 TTCAGGAAAGCAAGACTTCCAGG - Intronic
1028925656 7:96354626-96354648 TTCAAGAAAGCAGAAGTTGTAGG + Intergenic
1029015800 7:97314424-97314446 TTTAGGAAAACAGAAGTTACAGG + Intergenic
1029018818 7:97342422-97342444 TTCAGAAAAGAGGAAGTTTCTGG - Intergenic
1029150323 7:98475745-98475767 TTCAGAAAAGCAGAAGCTACAGG + Intergenic
1029347846 7:99991717-99991739 GGCAGAGAAGCAGAAGTTACAGG + Intergenic
1030382285 7:108825917-108825939 TTCTTGAGAGCAGAAGTTATTGG + Intergenic
1030603366 7:111613466-111613488 TTCAGGAAAGCAGAAGTTACAGG - Intergenic
1030606441 7:111643534-111643556 TTTAGGGAAGGAGAAGTCACAGG - Intergenic
1030902745 7:115145072-115145094 TACAGGAAAGCAAAAGCTAGAGG - Intergenic
1031353945 7:120767389-120767411 TTCAGGAAAGCTAAAGTTACAGG - Intergenic
1031416515 7:121502684-121502706 TTCAGGAAAGCAGAAGTTATAGG - Intergenic
1032101626 7:128983798-128983820 TTCAGGGATGTAGGAGTTACAGG - Intronic
1032165662 7:129542768-129542790 TTCTGGAAAGCAGAAAGTATGGG - Intergenic
1032319038 7:130868075-130868097 TTCATGAATGCAGAATTTATAGG + Intergenic
1033091993 7:138394308-138394330 ATCAGGAAAGCAGACGTTACAGG - Intergenic
1033105161 7:138514048-138514070 TTCTAGGAAGCAGAAGTCACTGG + Intronic
1034342320 7:150365795-150365817 TTCAGGAAAGGAGAAGTTATGGG + Intergenic
1034670028 7:152850785-152850807 TACAGGTAAGCAGAAGTCACAGG - Intronic
1035131723 7:156660845-156660867 TTTAGGGAGGCAGGAGTTACAGG + Intronic
1035457231 7:159016502-159016524 TTCAGGAAAGCAGAAGCTGCAGG - Intergenic
1036135988 8:6162157-6162179 TTCAGGAAAGCAGAAGTTACAGG + Intergenic
1036279775 8:7390902-7390924 ATTTGGAAAGCAGAGGTTACTGG - Intergenic
1036341744 8:7920981-7921003 ATTTGGAAAGCAGAGGTTACTGG + Intergenic
1036567555 8:9950517-9950539 TTCAGGAAAGAAGCACTTGCAGG - Intergenic
1037106010 8:15109633-15109655 TTCAGGAAAACAGAAATTATGGG + Intronic
1037670607 8:21012267-21012289 TTCAGGAAAGCAGAAATTACCGG - Intergenic
1037794481 8:21980392-21980414 TTCAGAAATGTAGGAGTTACAGG + Intronic
1038227028 8:25667056-25667078 TTCAGGAAAGCAGAAGTTACAGG + Intergenic
1038369433 8:26973200-26973222 TTCAGGAAAGCAGAAACTGCAGG - Intergenic
1038478980 8:27888505-27888527 TTCAGGAGAGCAGAAGTTACAGG - Intronic
1038522315 8:28244036-28244058 TTCAGGAAAACAAAAGCTACAGG - Intergenic
1038704992 8:29885134-29885156 TTCAGAAAAGCAGAAGTTACAGG - Intergenic
1038857754 8:31351620-31351642 TTCAGGAAAGCAGAAATTGGAGG + Intergenic
1039031818 8:33317563-33317585 TTCAGGAAAGCAGATGTTACAGG - Intergenic
1039116100 8:34092842-34092864 TTCAGGAAAGCAGAAACTACAGG + Intergenic
1039241350 8:35560228-35560250 TACAGGGGAGCAGAAGTTCCAGG - Intronic
1039344925 8:36693138-36693160 GGCAGGAAAGCAGAAATTACAGG - Intergenic
1039509764 8:38081678-38081700 TTCGGGAAAGCAGAAGTTACAGG - Intergenic
1039581221 8:38668257-38668279 TTCAGGAAATTAGAAGTTACTGG + Intergenic
1039743661 8:40404653-40404675 TTCAGGAAAGCAGAAGTTACAGG + Intergenic
1040417304 8:47206698-47206720 TTCAGGAAAGCAGAAGCTACAGG + Intergenic
1040497093 8:47975528-47975550 TTAAGGAAAGCAGCAGCTAGTGG + Intronic
1040683030 8:49836935-49836957 TTCAGGAAAGCAGAAATTAAAGG - Intergenic
1040779427 8:51090606-51090628 TTTAGGGAGACAGAAGTTACAGG + Intergenic
1040944777 8:52873262-52873284 TTCAGGAAAGCAGAAATAATAGG + Intergenic
1041751354 8:61264485-61264507 TTCAGGAAAGCAGAAGTTACAGG + Intronic
1041895861 8:62924130-62924152 TTCAGGAAAACAGATGTGGCTGG - Intronic
1041896659 8:62932600-62932622 ATCAGGAAGTCATAAGTTACTGG + Intronic
1042152260 8:65800461-65800483 TTCAGGAAAGCAGAAGCTACAGG - Intronic
1043193387 8:77256108-77256130 TTCCGGAAGGCACAAGTGACTGG + Intergenic
1043583972 8:81746211-81746233 TCCAGCCATGCAGAAGTTACTGG + Intronic
1044184222 8:89233295-89233317 TTTAGGGAGACAGAAGTTACAGG + Intergenic
1044607470 8:94059748-94059770 TTCAGAGAGGCAGGAGTTACAGG - Intergenic
1045290766 8:100830690-100830712 TTTAAGGAAACAGAAGTTACAGG + Intergenic
1045829368 8:106439954-106439976 TTCTGGATAGCTGAAGTTAATGG + Intronic
1046135526 8:110021153-110021175 TTCAGGAAACCAGAAATGAAAGG - Intergenic
1046543740 8:115620341-115620363 TTCAGGAAAGAATAAGTAATAGG - Intronic
1047188680 8:122658296-122658318 TTTAGGAAAACAGAAGTTACAGG + Intergenic
1048230182 8:132631628-132631650 TTCAGGATAGCAGACGCCACTGG + Intronic
1048536339 8:135299477-135299499 TTCAGGATAGCAAAATTTCCAGG - Intergenic
1048869915 8:138788893-138788915 ATGAGGAAAGCAAAGGTTACAGG + Intronic
1048893441 8:138967772-138967794 TTCAGGAAAGCACAAGTTACAGG + Intergenic
1049305201 8:141899186-141899208 TCCAGGAAAGCCCAAGTTCCAGG + Intergenic
1049511991 8:143032494-143032516 TTCAGGAAAGCAGAAGTTGCAGG - Intergenic
1049544449 8:143223152-143223174 TTTAGGGAGACAGAAGTTACAGG + Intergenic
1050290785 9:4152218-4152240 TTCTAGAAATCAGAAGTGACTGG + Intronic
1050547082 9:6718181-6718203 TTCAGGAAAGCCAAAGTTACAGG - Intergenic
1050684273 9:8149227-8149249 TTCAGGAAAGCAAAGGCTAAGGG + Intergenic
1052593377 9:30527863-30527885 TGCAAGCAAGCTGAAGTTACAGG + Intergenic
1052729475 9:32268269-32268291 TGGAGGAAAGCAGAACTGACAGG + Intergenic
1052829091 9:33200274-33200296 TTTGGGGAAGCAGAAGTTACAGG - Intergenic
1053044759 9:34906278-34906300 TTTAGGGAGGCAGAAGTTACAGG + Intergenic
1053331248 9:37209799-37209821 TTCTGGAGAGAATAAGTTACTGG + Intronic
1053539986 9:38963598-38963620 TTCAGGGAGGCAGGAGTTACGGG + Intergenic
1053804338 9:41785755-41785777 TTCAGGGAGGCAGGAGTTACAGG + Intergenic
1054140945 9:61529707-61529729 TTCAGGGAGGCAGGAGTTACAGG - Intergenic
1054192642 9:61997246-61997268 TTCAGGGAGGCAGGAGTTACAGG + Intergenic
1054626155 9:67400321-67400343 TTCAGGGAGGCAGGAGTTACGGG - Intergenic
1054645762 9:67591445-67591467 TTCAGGGAGGCAGGAGTTACAGG - Intergenic
1055045671 9:71921563-71921585 TTTAGGAAGACAGAAGTTACAGG - Intronic
1055485176 9:76749510-76749532 TTCAGAAAATCAGAAGTTACAGG - Intronic
1055665916 9:78553031-78553053 TTCAGCAAATCAGAAGTGCCTGG + Intergenic
1055832767 9:80401655-80401677 TTCAGAGAGACAGAAGTTACAGG - Intergenic
1056283706 9:85067122-85067144 TTTAGGGAGACAGAAGTTACAGG - Intergenic
1056391269 9:86143824-86143846 TTCATGAAAGTGGGAGTTACAGG - Intergenic
1056501641 9:87215472-87215494 TTCAGGAAAGCAGAAGTTATAGG - Intergenic
1056600908 9:88046171-88046193 TTTAGGGAGACAGAAGTTACAGG - Intergenic
1056899500 9:90584679-90584701 AACAGGAAAGCAGAACATACTGG + Intergenic
1056911402 9:90704215-90704237 TTCAGGAAAACAGAAATTTCAGG + Intergenic
1056956254 9:91083966-91083988 TTTAGGCAGACAGAAGTTACAGG + Intergenic
1057243468 9:93433858-93433880 ATCAGGAGAACAGAAGTTAGGGG - Intergenic
1057629700 9:96709380-96709402 TTCAGGAAAGCAGAAGCTGTAGG - Intergenic
1057888634 9:98851130-98851152 CTTAGGGAAACAGAAGTTACAGG - Intergenic
1057981490 9:99668458-99668480 TTTAGCAAGACAGAAGTTACAGG + Intergenic
1058001365 9:99869342-99869364 TTCAGGAAAGCAGAAGTTACAGG + Intergenic
1058787699 9:108406448-108406470 TTTAGGGAGGCAGGAGTTACAGG - Intergenic
1059578293 9:115515877-115515899 TTCTAGAAAGGAAAAGTTACTGG + Intergenic
1059906843 9:118996306-118996328 TTCAGGAAAGCAAAATTATCAGG - Intergenic
1061115623 9:128609280-128609302 TCCAGGTAAGCTGAAGTGACTGG + Exonic
1185662410 X:1737783-1737805 TTTAGGGAGACAGAAGTTACAGG + Intergenic
1185677762 X:1862376-1862398 TTCAGGAAAGCAGAAGGTACAGG + Intergenic
1185840398 X:3384046-3384068 TTCATGGAGGCAGAGGTTACAGG - Intergenic
1185975982 X:4720488-4720510 TTTAGGAAGACAGAAGTTACAGG - Intergenic
1186026506 X:5319464-5319486 TTCAGTAAAGCAGAAGTCACAGG + Intergenic
1186055395 X:5644259-5644281 TTCAGGAAAATGGAAGCTACAGG + Intergenic
1186057684 X:5667365-5667387 TTCAGGAAAGCAGAAACTACAGG - Intergenic
1186130603 X:6461547-6461569 GTCAGGAAAGTAGAAGCTACAGG - Intergenic
1186175911 X:6925650-6925672 TTTAAGAAGACAGAAGTTACAGG + Intergenic
1186511353 X:10132199-10132221 TTCAGGAAAGCGGCAGTCACAGG + Intronic
1186713098 X:12221004-12221026 TTCAGGAACCCAGAACCTACGGG - Intronic
1186977149 X:14919734-14919756 TTAAGGAAAGCAGCAGCTGCTGG - Exonic
1187101729 X:16199724-16199746 TTTAGGGAGGCAGAAGTTACAGG - Intergenic
1187112441 X:16315447-16315469 TTCAGGAGTGCAGAAGTTATAGG - Intergenic
1187256838 X:17651031-17651053 TTCCTGAAAGCTGAAGTTATTGG - Intronic
1187854553 X:23624255-23624277 TTCAAGAAAGCAGAAGCTACAGG - Intergenic
1188074154 X:25754820-25754842 TTTAGGAAGACAGCAGTTACAGG - Intergenic
1188212116 X:27439313-27439335 TTCAGAAAAGCAGGAGTTACAGG + Intergenic
1189893283 X:45628033-45628055 TTCAGGAAATCAGAAGTTAAAGG + Intergenic
1190389920 X:49921907-49921929 CTCAGAAAAGCTGAAGTCACAGG - Intergenic
1192680857 X:73252719-73252741 TTTAGGGAGACAGAAGTTACAGG + Intergenic
1193996038 X:88366668-88366690 TTCAGGAAAGCAAATGAAACAGG - Intergenic
1194026789 X:88763051-88763073 TTCAGAAAAGCAAATGTTAAAGG - Intergenic
1194075016 X:89380462-89380484 TTTAGGAAGACAGAAGTTACAGG + Intergenic
1194822248 X:98523981-98524003 TTTAGGAAGGCAGGAATTACAGG - Intergenic
1194843919 X:98779888-98779910 TTCAGGGAAGCAGAAGTTAGAGG + Intergenic
1194893791 X:99414292-99414314 TTCAGGAAAGCATACGCTAAGGG - Intergenic
1195657260 X:107343970-107343992 TTTAGGGAAGCAGGAGTTACAGG - Intergenic
1196636017 X:118003683-118003705 TACAGGAAAGCAGAATTTATAGG + Intronic
1197067218 X:122247704-122247726 TTTAGGGAGACAGAAGTTACTGG - Intergenic
1197875216 X:131095710-131095732 TTAACTAAAGCAGAAGCTACTGG - Intergenic
1197963879 X:132035287-132035309 TTAAGGAAAACAGAAGTCATGGG - Intergenic
1198070289 X:133141611-133141633 TCCAGAAAAGCAGAAATGACAGG - Intergenic
1198258924 X:134949105-134949127 TTCAGGGAAGTAGAAGTTACAGG - Intergenic
1198705870 X:139447419-139447441 CTCAGAAAAGCAGGAGATACTGG + Intergenic
1198933344 X:141882121-141882143 CTCAGGACAGGAGAAGTTTCTGG - Intronic
1198959840 X:142172869-142172891 TTCAGGACAGGAGAAGTTGCTGG + Intergenic
1198984089 X:142429347-142429369 TTCAGGAAAGCAGAAGTTACAGG + Intergenic
1199043322 X:143139908-143139930 TTGAGGAAAACAGAATTTACTGG + Intergenic
1199497833 X:148472824-148472846 TTCAAGAAGGCACAAGTTAAAGG - Intergenic
1199579828 X:149350127-149350149 TTCAGGAAAGCAGAAGTTGTAGG - Intergenic
1199992959 X:152999584-152999606 TTCAGGAAAGCAGAAGTTACAGG - Intergenic
1199995185 X:153019776-153019798 TTCACGAAAGCAAAAGTTACAGG - Intergenic
1200002116 X:153067479-153067501 TAAGGGAAAGCAGAAGATACAGG - Intergenic
1200005617 X:153082546-153082568 TAAGGGAAAGCAGAAGATACAGG + Intergenic
1200730616 Y:6734632-6734654 TTTAGGAAGATAGAAGTTACAGG + Intergenic
1201235579 Y:11907838-11907860 TTCATGGAGGCAGAGGTTACAGG + Intergenic
1201537443 Y:15066507-15066529 TTCTGGAAAGCAGAAACTACAGG + Intergenic
1201643906 Y:16206257-16206279 TTCAGGAATGCAGAAGTCACAGG - Intergenic
1201658909 Y:16379064-16379086 TTCAGGAATGCAGAAGTCACAGG + Intergenic
1201706168 Y:16939540-16939562 TTTAGAGAAGCAGAAGTTATAGG - Intergenic