ID: 923872616

View in Genome Browser
Species Human (GRCh38)
Location 1:238012462-238012484
Sequence GCAGCAAGAAATTGCAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923872616_923872617 -10 Left 923872616 1:238012462-238012484 CCTGTTTTGCAATTTCTTGCTGC No data
Right 923872617 1:238012475-238012497 TTCTTGCTGCAGTTGAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923872616 Original CRISPR GCAGCAAGAAATTGCAAAAC AGG (reversed) Intergenic
No off target data available for this crispr