ID: 923879115

View in Genome Browser
Species Human (GRCh38)
Location 1:238084198-238084220
Sequence CAGCTGACACCCACCCACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923879115_923879118 11 Left 923879115 1:238084198-238084220 CCTTTGTGGGTGGGTGTCAGCTG No data
Right 923879118 1:238084232-238084254 ATTTTCCTTTCTGCTCTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923879115 Original CRISPR CAGCTGACACCCACCCACAA AGG (reversed) Intergenic
No off target data available for this crispr