ID: 923879806

View in Genome Browser
Species Human (GRCh38)
Location 1:238091336-238091358
Sequence TCTGCAGCTCCTCCGTAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923879797_923879806 28 Left 923879797 1:238091285-238091307 CCGAACAGCAGCACTGAGGAGGT No data
Right 923879806 1:238091336-238091358 TCTGCAGCTCCTCCGTAGTGGGG No data
923879803_923879806 3 Left 923879803 1:238091310-238091332 CCACATGGTGGTCAGGCGGGATT No data
Right 923879806 1:238091336-238091358 TCTGCAGCTCCTCCGTAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923879806 Original CRISPR TCTGCAGCTCCTCCGTAGTG GGG Intergenic
No off target data available for this crispr