ID: 923881710

View in Genome Browser
Species Human (GRCh38)
Location 1:238110929-238110951
Sequence ACTTGGGCTGACACTCTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923881703_923881710 6 Left 923881703 1:238110900-238110922 CCTGTGGTGCCGTATAAGCCATT No data
Right 923881710 1:238110929-238110951 ACTTGGGCTGACACTCTGAATGG No data
923881706_923881710 -3 Left 923881706 1:238110909-238110931 CCGTATAAGCCATTGGGAAGACT No data
Right 923881710 1:238110929-238110951 ACTTGGGCTGACACTCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923881710 Original CRISPR ACTTGGGCTGACACTCTGAA TGG Intergenic
No off target data available for this crispr