ID: 923882921

View in Genome Browser
Species Human (GRCh38)
Location 1:238123334-238123356
Sequence CCTCCCAGGAGCTTCGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923882912_923882921 30 Left 923882912 1:238123281-238123303 CCTTGTCTTCGGAGAGGACATTC No data
Right 923882921 1:238123334-238123356 CCTCCCAGGAGCTTCGCTGGAGG No data
923882918_923882921 -10 Left 923882918 1:238123321-238123343 CCTCACAGGGTGTCCTCCCAGGA No data
Right 923882921 1:238123334-238123356 CCTCCCAGGAGCTTCGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923882921 Original CRISPR CCTCCCAGGAGCTTCGCTGG AGG Intergenic