ID: 923887706

View in Genome Browser
Species Human (GRCh38)
Location 1:238177374-238177396
Sequence GTAAAGAATTAGACCACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923887706_923887711 0 Left 923887706 1:238177374-238177396 CCCTCAGTGGTCTAATTCTTTAC No data
Right 923887711 1:238177397-238177419 TCTTGGGAACTGAAGGTTTCTGG No data
923887706_923887714 21 Left 923887706 1:238177374-238177396 CCCTCAGTGGTCTAATTCTTTAC No data
Right 923887714 1:238177418-238177440 GGCCTAGGCCACTCTTCAGTGGG No data
923887706_923887713 20 Left 923887706 1:238177374-238177396 CCCTCAGTGGTCTAATTCTTTAC No data
Right 923887713 1:238177417-238177439 TGGCCTAGGCCACTCTTCAGTGG No data
923887706_923887717 30 Left 923887706 1:238177374-238177396 CCCTCAGTGGTCTAATTCTTTAC No data
Right 923887717 1:238177427-238177449 CACTCTTCAGTGGGATCTTGAGG No data
923887706_923887712 6 Left 923887706 1:238177374-238177396 CCCTCAGTGGTCTAATTCTTTAC No data
Right 923887712 1:238177403-238177425 GAACTGAAGGTTTCTGGCCTAGG No data
923887706_923887710 -7 Left 923887706 1:238177374-238177396 CCCTCAGTGGTCTAATTCTTTAC No data
Right 923887710 1:238177390-238177412 TCTTTACTCTTGGGAACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923887706 Original CRISPR GTAAAGAATTAGACCACTGA GGG (reversed) Intergenic
No off target data available for this crispr