ID: 923892953

View in Genome Browser
Species Human (GRCh38)
Location 1:238235849-238235871
Sequence GAGTCTCTCCCAGCTCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923892953_923892957 12 Left 923892953 1:238235849-238235871 CCTGGAGGAGCTGGGAGAGACTC No data
Right 923892957 1:238235884-238235906 AGCAGGCAAAAAAAAAAAAATGG No data
923892953_923892954 -5 Left 923892953 1:238235849-238235871 CCTGGAGGAGCTGGGAGAGACTC No data
Right 923892954 1:238235867-238235889 GACTCCCATGTGACAACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923892953 Original CRISPR GAGTCTCTCCCAGCTCCTCC AGG (reversed) Intergenic
No off target data available for this crispr