ID: 923892954

View in Genome Browser
Species Human (GRCh38)
Location 1:238235867-238235889
Sequence GACTCCCATGTGACAACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923892953_923892954 -5 Left 923892953 1:238235849-238235871 CCTGGAGGAGCTGGGAGAGACTC No data
Right 923892954 1:238235867-238235889 GACTCCCATGTGACAACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923892954 Original CRISPR GACTCCCATGTGACAACAGC AGG Intergenic
No off target data available for this crispr