ID: 923897471

View in Genome Browser
Species Human (GRCh38)
Location 1:238288095-238288117
Sequence CCTTGTCTGCAGAAGTTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923897471_923897475 17 Left 923897471 1:238288095-238288117 CCTTACAACTTCTGCAGACAAGG No data
Right 923897475 1:238288135-238288157 TTGGATTGCTTAAGATGACATGG No data
923897471_923897473 -2 Left 923897471 1:238288095-238288117 CCTTACAACTTCTGCAGACAAGG No data
Right 923897473 1:238288116-238288138 GGATCCTGAGAAATGTTGATTGG No data
923897471_923897476 18 Left 923897471 1:238288095-238288117 CCTTACAACTTCTGCAGACAAGG No data
Right 923897476 1:238288136-238288158 TGGATTGCTTAAGATGACATGGG No data
923897471_923897477 19 Left 923897471 1:238288095-238288117 CCTTACAACTTCTGCAGACAAGG No data
Right 923897477 1:238288137-238288159 GGATTGCTTAAGATGACATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923897471 Original CRISPR CCTTGTCTGCAGAAGTTGTA AGG (reversed) Intergenic
No off target data available for this crispr