ID: 923897473

View in Genome Browser
Species Human (GRCh38)
Location 1:238288116-238288138
Sequence GGATCCTGAGAAATGTTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923897471_923897473 -2 Left 923897471 1:238288095-238288117 CCTTACAACTTCTGCAGACAAGG No data
Right 923897473 1:238288116-238288138 GGATCCTGAGAAATGTTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923897473 Original CRISPR GGATCCTGAGAAATGTTGAT TGG Intergenic
No off target data available for this crispr