ID: 923897475 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:238288135-238288157 |
| Sequence | TTGGATTGCTTAAGATGACA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 923897474_923897475 | -8 | Left | 923897474 | 1:238288120-238288142 | CCTGAGAAATGTTGATTGGATTG | No data | ||
| Right | 923897475 | 1:238288135-238288157 | TTGGATTGCTTAAGATGACATGG | No data | ||||
| 923897471_923897475 | 17 | Left | 923897471 | 1:238288095-238288117 | CCTTACAACTTCTGCAGACAAGG | No data | ||
| Right | 923897475 | 1:238288135-238288157 | TTGGATTGCTTAAGATGACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 923897475 | Original CRISPR | TTGGATTGCTTAAGATGACA TGG | Intergenic | ||
| No off target data available for this crispr | |||||