ID: 923899651

View in Genome Browser
Species Human (GRCh38)
Location 1:238311876-238311898
Sequence TGATAGGCAGAGAATTGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923899648_923899651 22 Left 923899648 1:238311831-238311853 CCAGGCTTGCATTCACAGGGTTT No data
Right 923899651 1:238311876-238311898 TGATAGGCAGAGAATTGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923899651 Original CRISPR TGATAGGCAGAGAATTGTAG AGG Intergenic
No off target data available for this crispr