ID: 923904605

View in Genome Browser
Species Human (GRCh38)
Location 1:238369906-238369928
Sequence CATGAGAGGGACCCAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923904605_923904610 -6 Left 923904605 1:238369906-238369928 CCTTCCACTGGGTCCCTCTCATG No data
Right 923904610 1:238369923-238369945 CTCATGACACATGGAAATTATGG 0: 4
1: 50
2: 372
3: 1425
4: 3423
923904605_923904614 21 Left 923904605 1:238369906-238369928 CCTTCCACTGGGTCCCTCTCATG No data
Right 923904614 1:238369950-238369972 TGCAATTAGAGATTTGAGTGGGG No data
923904605_923904612 19 Left 923904605 1:238369906-238369928 CCTTCCACTGGGTCCCTCTCATG No data
Right 923904612 1:238369948-238369970 GCTGCAATTAGAGATTTGAGTGG No data
923904605_923904613 20 Left 923904605 1:238369906-238369928 CCTTCCACTGGGTCCCTCTCATG No data
Right 923904613 1:238369949-238369971 CTGCAATTAGAGATTTGAGTGGG No data
923904605_923904611 -5 Left 923904605 1:238369906-238369928 CCTTCCACTGGGTCCCTCTCATG No data
Right 923904611 1:238369924-238369946 TCATGACACATGGAAATTATGGG 0: 3
1: 48
2: 396
3: 1479
4: 3482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923904605 Original CRISPR CATGAGAGGGACCCAGTGGA AGG (reversed) Intergenic
No off target data available for this crispr