ID: 923914971

View in Genome Browser
Species Human (GRCh38)
Location 1:238491893-238491915
Sequence CCACATCCATGGGCTCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 5, 2: 20, 3: 42, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923914966_923914971 -1 Left 923914966 1:238491871-238491893 CCATGCGCCAGTCTGTGGAGAGC 0: 8
1: 18
2: 13
3: 23
4: 120
Right 923914971 1:238491893-238491915 CCACATCCATGGGCTCTGCAAGG 0: 1
1: 5
2: 20
3: 42
4: 241
923914967_923914971 -8 Left 923914967 1:238491878-238491900 CCAGTCTGTGGAGAGCCACATCC No data
Right 923914971 1:238491893-238491915 CCACATCCATGGGCTCTGCAAGG 0: 1
1: 5
2: 20
3: 42
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923914971 Original CRISPR CCACATCCATGGGCTCTGCA AGG Intergenic
900743715 1:4345911-4345933 TCACATTCATGGGCTCTAGATGG + Intergenic
901462549 1:9400282-9400304 CCAGCTTCATGGGGTCTGCAGGG + Intergenic
901720498 1:11193473-11193495 ACACATCTACTGGCTCTGCAGGG + Intronic
902218891 1:14952107-14952129 CAGCAGCCATGGTCTCTGCAAGG + Intronic
902249470 1:15144587-15144609 CCACACCCAGGGCTTCTGCAGGG - Intergenic
905249840 1:36640867-36640889 CCACCTCCATGAAGTCTGCAAGG + Intergenic
905572129 1:39014385-39014407 CCACCTGCGAGGGCTCTGCAGGG + Intergenic
905758738 1:40535337-40535359 CCATATTCATGGGTTTTGCATGG + Intronic
907310063 1:53534100-53534122 CCCCATCCATAGGCTGTGTAGGG + Intronic
912350446 1:109007599-109007621 CCAAAGCCATGAGCTCTGAAAGG + Intronic
914241132 1:145853904-145853926 CCAGAGCCATGGGGTCAGCAAGG + Intronic
914412753 1:147447189-147447211 CCACGGCCATGGGCTTTGCTTGG - Intergenic
916560764 1:165932613-165932635 CCACAGGCTTGGGCTTTGCAGGG + Intergenic
918082936 1:181221502-181221524 CCACTTCCCTGGGCACTGCCTGG - Intergenic
918276709 1:182959805-182959827 TGACATCCAGGGGCTCCGCAAGG - Intergenic
918431684 1:184467434-184467456 CCATATCCAAGGGCTCTAAAGGG - Intronic
919922995 1:202177404-202177426 CCACACCCCAGGGCCCTGCAGGG + Intergenic
920229898 1:204463386-204463408 CCACTACCCTGGGCTCTGGAGGG - Intronic
922160363 1:223075028-223075050 GCACAGTCATGGGCTGTGCAGGG + Intergenic
922449302 1:225723937-225723959 CTGCAACTATGGGCTCTGCAGGG + Intergenic
922534518 1:226370043-226370065 TCTCCTCCATGGGTTCTGCAGGG + Intronic
922560921 1:226568991-226569013 GCACATGCATGGGCACAGCAAGG - Intronic
923678602 1:236101001-236101023 CCACAGCCCTGGGCCCGGCAAGG + Intergenic
923914971 1:238491893-238491915 CCACATCCATGGGCTCTGCAAGG + Intergenic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1065628334 10:27653616-27653638 CCACAACCAGGGACTCTGCAAGG - Intergenic
1069346059 10:67471192-67471214 TCACATCCCTGGCCTCTACATGG + Intronic
1072678101 10:97483838-97483860 CCAAAGCCATGGGCTGTGCCAGG + Intronic
1072877439 10:99188031-99188053 TCATATCCATGGTTTCTGCAAGG + Intronic
1074873476 10:117595929-117595951 CCTCATGCAGGGGCACTGCATGG - Intergenic
1075327080 10:121542442-121542464 CCAGATCCATTGGTTCTGCAGGG - Intronic
1075565991 10:123504777-123504799 CCCCATCCATGTGCTCTACCTGG + Intergenic
1075707391 10:124509836-124509858 CCTTATCCAGGGGCTCTGCCAGG - Intronic
1077563511 11:3281276-3281298 CCCCATCAATGGGCTCTGGACGG - Intergenic
1077569403 11:3327091-3327113 CCCCATCAATGGGCTCTAGACGG - Intergenic
1077842939 11:5994602-5994624 CGAAATCCATGGGCTCCACAAGG - Intergenic
1080430249 11:32191485-32191507 CAGCAGCCATGGGGTCTGCAAGG - Intergenic
1081077355 11:38693508-38693530 ACACATGCATTGGCTGTGCAAGG - Intergenic
1083196821 11:61093205-61093227 TCACATCCCTGGGCTTAGCATGG + Intergenic
1083756122 11:64792476-64792498 CCACCTCATAGGGCTCTGCAGGG - Intronic
1085445706 11:76599347-76599369 CCACATCCCTGGGGTCTGCTGGG - Intergenic
1086965680 11:93025692-93025714 CCACGTCCCTGTTCTCTGCAAGG + Intergenic
1088135496 11:106552045-106552067 CCTCCTCCATGGCTTCTGCAGGG + Intergenic
1090829513 11:130411227-130411249 CCACCTAAATGGGCTCTGCAAGG - Intronic
1091643455 12:2255057-2255079 CCACAGCCGTGGCATCTGCAGGG - Intronic
1091669795 12:2444855-2444877 CCGCCTCCATGATCTCTGCATGG + Intronic
1092196527 12:6552906-6552928 CGATATCCATGTGTTCTGCATGG + Intronic
1093442816 12:19219166-19219188 TCACATACATGGGCTCTGCAAGG + Intronic
1096535129 12:52267188-52267210 CCACAACCAGGGACTCTACATGG - Intronic
1096540799 12:52305897-52305919 CCACAACCAGGGACTCTACATGG - Intronic
1096634710 12:52950789-52950811 CGACATCCATGGGCTCCGCAAGG + Exonic
1097950237 12:65419459-65419481 CGACATCTATGGGCTCTGCAAGG - Intronic
1097984366 12:65768142-65768164 CCACAGCCATGGACCTTGCATGG + Intergenic
1101468988 12:104977479-104977501 TGACATCCATGGGCTCCGCAAGG - Intergenic
1101880563 12:108623017-108623039 CCACCTCCACGGGCTCTCCTGGG - Exonic
1102145148 12:110649683-110649705 CCACATCCCAGGGCTCTGCCAGG - Intronic
1104634179 12:130427405-130427427 CCGCATTCATGTGCTCTGCAGGG - Intronic
1104763666 12:131313201-131313223 CCGCACCCATGGCCTCTGCTTGG + Intergenic
1104850119 12:131868695-131868717 CCACATCCCAGGTCCCTGCAGGG + Intergenic
1107964979 13:45589844-45589866 ACACCTCCAGGGGCACTGCAAGG - Intronic
1109215018 13:59579715-59579737 CCAAATCCAAGAGCTCTGAAAGG + Intergenic
1111581683 13:90230930-90230952 TGACATCCATGGGCTCTGCAAGG + Intergenic
1112350253 13:98627221-98627243 CCCCATCCCTGGTGTCTGCAGGG - Intergenic
1113100937 13:106717220-106717242 TTATATCCATGGGTTCTGCAAGG + Intergenic
1113346522 13:109483239-109483261 TCACAGCCATGCGTTCTGCAGGG + Intergenic
1113999590 14:16401149-16401171 TCTCTTCCAGGGGCTCTGCAAGG - Intergenic
1114412263 14:22512212-22512234 CCACATCCATGGACTGTGGAAGG + Intergenic
1114621348 14:24098212-24098234 CCACATCCTTGGGGTCTGTGCGG - Exonic
1116861696 14:50000775-50000797 CCACATCCCTGTCCACTGCATGG - Intronic
1117388485 14:55240598-55240620 CCCCATGGATGGGCTTTGCAAGG - Intergenic
1118085599 14:62412434-62412456 CCAGATACATGGTCTCTGAAAGG + Intergenic
1118966850 14:70595092-70595114 CAACATCCATGGGCTCTGCAAGG + Intronic
1119407150 14:74406035-74406057 CCACAGCCCTGGGCTCTGGATGG + Exonic
1121458496 14:94054925-94054947 CCACAGCAAGGTGCTCTGCAAGG + Intronic
1121585609 14:95060979-95061001 CCACCTCCAGGGCCTCTGCTAGG - Intergenic
1122824849 14:104364618-104364640 CCACGTCGCTGGGCTCAGCAGGG + Intergenic
1122973682 14:105162523-105162545 CCACAGCCCAGGGCACTGCATGG + Intronic
1125598593 15:40903139-40903161 CCCCAGCCAAGGGCTCTGCCCGG + Exonic
1126051553 15:44690242-44690264 CCAAATCCATAGGCTATGAAGGG + Intronic
1127366858 15:58299413-58299435 TCACAGCCATGGGCTCTGAAGGG + Intronic
1128554679 15:68623399-68623421 CCACATGCATGGACACTGCCAGG - Intronic
1132321473 15:100928786-100928808 CCACATCCAGGGGCTTTGAAAGG - Intronic
1132716803 16:1294562-1294584 CCACATCCATGGGGTGGGCCTGG + Intergenic
1136019218 16:27429425-27429447 CTACATCAATAGGCTCAGCAAGG + Intronic
1136597322 16:31260290-31260312 CCACATTCATGGACTGTGCAAGG + Intronic
1138056662 16:53841540-53841562 CCAAGTTCATGGTCTCTGCAAGG - Intronic
1138402074 16:56754587-56754609 CCCCATGCTTTGGCTCTGCAGGG + Intronic
1140181962 16:72729154-72729176 TGACATCCATGGGCTCTGCAAGG + Intergenic
1140862597 16:79031242-79031264 CCCCACACGTGGGCTCTGCAGGG - Intronic
1142045068 16:87920010-87920032 CCCCATCCATGGACTCAGGAGGG + Intronic
1142197632 16:88746069-88746091 CCTGATCCATGGGGTGTGCATGG + Intronic
1142219420 16:88846364-88846386 ACACAGCCATGGGCTCCGGACGG + Intronic
1142343977 16:89542234-89542256 CCACAGCCCTGGCCTCTGCAAGG + Intronic
1142402857 16:89870039-89870061 CCACTTCCCAGGTCTCTGCAAGG + Exonic
1144103209 17:11962211-11962233 CTACATCCATGGCCTCTTCATGG + Exonic
1144103279 17:11962799-11962821 CCACATTCATGAGCTCTCAAAGG + Intronic
1145871427 17:28276782-28276804 TGACATCCATGGGCTCCACAAGG - Intergenic
1147690272 17:42310543-42310565 CCACATCCATGGTCTCATCCAGG - Exonic
1148066636 17:44875785-44875807 GCACATCCTGGGACTCTGCAGGG - Intronic
1148322095 17:46763402-46763424 CCAGATCCTTGGGAACTGCATGG + Exonic
1149936340 17:60810705-60810727 GGACATCCATGGGCTCTGCAAGG + Intronic
1150307351 17:64097169-64097191 CCACCTGCATGGGCCCTGCTTGG - Intronic
1150604368 17:66678293-66678315 CCAAAATCAGGGGCTCTGCAGGG - Intronic
1151130262 17:71889570-71889592 CCACCCCCTTTGGCTCTGCAAGG + Intergenic
1151215285 17:72572884-72572906 GCAGATTCATGAGCTCTGCAAGG - Intergenic
1153098883 18:1441203-1441225 CCACATGCATGGGCACTCCTGGG + Intergenic
1153907865 18:9678975-9678997 TGACATCCATGGGCTCCGCAAGG - Intergenic
1153962033 18:10148049-10148071 CCACAACACTGGGCTCTGCAGGG - Intergenic
1160015113 18:75134208-75134230 CCCCAGGCAGGGGCTCTGCACGG + Intergenic
1160228959 18:77032141-77032163 CAAATTCCATGGTCTCTGCAGGG - Intronic
1160251430 18:77206915-77206937 CCACAGCCAAGGGCCCTGCTGGG + Intergenic
1160432362 18:78820350-78820372 CCACAGCGATGGCCTCTGCAAGG + Intergenic
1161281430 19:3447798-3447820 CCACACCCAGGGGCTTTCCAGGG + Intronic
1162550780 19:11357198-11357220 CTTCCTCCATGGCCTCTGCAGGG - Intronic
1166208557 19:41289999-41290021 CCACATCCAGCCGCTCTCCATGG + Intronic
1166295657 19:41888064-41888086 CCATCTCCCTGGGCTCTGCAGGG - Exonic
1166518018 19:43461644-43461666 CCACAGTCGTGGGCTCTGGAGGG + Exonic
925031257 2:651421-651443 CCTCATGCATGGGCTCTGCATGG + Intergenic
925152629 2:1625612-1625634 CCACATTCCTGGCCTCTGCAAGG + Intergenic
925953626 2:8939264-8939286 CCACATCCATGTCCTGTGCCTGG + Intronic
926036095 2:9637106-9637128 CCATATCTATGGTCTATGCAAGG + Intergenic
926226440 2:10970485-10970507 TCGGATCCTTGGGCTCTGCAGGG - Intergenic
927189372 2:20506636-20506658 CCAGCTCCGTGTGCTCTGCAGGG - Intergenic
927477062 2:23421370-23421392 CCACTTCCCTGTGCTCTGTAGGG - Intronic
928495097 2:31823334-31823356 CGACATCCATGGGCTCTGCGAGG - Intergenic
929571725 2:43027000-43027022 CCACATGCATGGGCTCTCTTCGG + Intergenic
929849002 2:45564834-45564856 TCATATACATGGGTTCTGCAGGG + Intronic
930063494 2:47310250-47310272 CCACAGACTTGGGCTCTGAAAGG + Intergenic
930698899 2:54439618-54439640 CCACATTCAGGGGGTCAGCAGGG + Intergenic
931791394 2:65667004-65667026 CGACATCCATGGGCTCCGCAAGG + Intergenic
932743148 2:74307453-74307475 CGACATCCGTGGGCTCCACAAGG - Intronic
935633909 2:105235245-105235267 CCAGATCCATGGGAGATGCAGGG - Intergenic
936282062 2:111150627-111150649 AGACAGCAATGGGCTCTGCAAGG - Intronic
937288828 2:120769611-120769633 GCACATGCATGAGCACTGCAGGG - Intronic
937976032 2:127582566-127582588 CCAGATCCGTGTGCTCTGCATGG + Intronic
940782344 2:157946034-157946056 CCACAACCCTAGGCTCTGAAGGG + Intronic
942971373 2:181961917-181961939 TGACATCCATGGGCTCCACAAGG - Intronic
943548666 2:189311977-189311999 TGACATCCATGGGCTCCACAAGG - Intergenic
944855728 2:203765025-203765047 CGACATCCATGGGCTCCACAAGG - Intergenic
944873289 2:203935433-203935455 CCACAGCCAAGGGGTCTGCAAGG - Intergenic
944993259 2:205262512-205262534 CCACAGCCATATGCTCTGAAAGG - Intronic
945528987 2:210926486-210926508 CTACAACCCTAGGCTCTGCAGGG - Intergenic
1170515796 20:17129213-17129235 CCACAGGCCTGCGCTCTGCAAGG + Intergenic
1171140087 20:22733528-22733550 CTACCTCCATGGGCTCTGCAAGG - Intergenic
1171727010 20:28633299-28633321 TCTCTTCCAGGGGCTCTGCAAGG - Intergenic
1171751250 20:29051319-29051341 TCCCTTCCAGGGGCTCTGCAAGG + Intergenic
1171856619 20:30350270-30350292 TCCCTTCCAGGGGCTCTGCAAGG + Intergenic
1172275651 20:33677476-33677498 CCATAACCATCTGCTCTGCAGGG + Exonic
1174349582 20:49957282-49957304 CGACATCCATGGGCTCTGCAAGG + Intergenic
1174454887 20:50641958-50641980 ACACATCCAAGGGCTCTGCAGGG - Intronic
1174471915 20:50767772-50767794 ACACATCCAAGGGCTCTGCAGGG + Intergenic
1175259355 20:57664819-57664841 CCACACCCAAGGCATCTGCAGGG + Intronic
1175466661 20:59194238-59194260 CCGTATCCATCGCCTCTGCATGG + Exonic
1175877436 20:62237040-62237062 CCACATCTCTGGGCCCAGCAGGG - Intronic
1176145522 20:63563697-63563719 GGACATCGATGGGCTCTGCCAGG - Exonic
1176237463 20:64060336-64060358 CCACATCCATGGAGCCTGCCTGG - Intronic
1176379350 21:6104079-6104101 GCACCTCCATGGGATCTGCCAGG + Intergenic
1178382348 21:32121341-32121363 CCCCCTCCATGGGCACTGGATGG + Intergenic
1179503320 21:41823317-41823339 CCACATCCATGTCCACTTCAAGG - Exonic
1179744123 21:43434158-43434180 GCACCTCCATGGGATCTGCCAGG - Intergenic
1179960730 21:44765863-44765885 CAACATGCATGGCCACTGCAGGG + Intergenic
1180391350 22:12285717-12285739 TCCCTTCCAGGGGCTCTGCAAGG - Intergenic
1180408392 22:12579037-12579059 TCCCTTCCAGGGGCTCTGCAAGG + Intergenic
1180622709 22:17172348-17172370 CCTCATCCAAGGTCTTTGCACGG + Intergenic
1180887577 22:19258061-19258083 CGACATCCATGGGCTCTGCAAGG + Intronic
1181133493 22:20748499-20748521 TCACACCCCTGGGCTCTGCCAGG - Intronic
1181235509 22:21445798-21445820 CCAGATCCATGGGCTCATCAGGG - Exonic
1181498254 22:23300560-23300582 GCACATCCATGGGCTCTCGGGGG + Intronic
1181771839 22:25131387-25131409 CCACACCCATGGGCCTAGCAAGG + Intronic
1182924416 22:34109063-34109085 CAATATCCATGTGCTCTTCAGGG - Intergenic
1183086255 22:35489130-35489152 ACACAGCCAATGGCTCTGCAGGG + Intergenic
1183605659 22:38865726-38865748 CCTCATCCTTGGCCTCTGCCTGG + Exonic
1184068118 22:42131662-42131684 CCACATTCCTGGGCTCTGGCCGG + Intergenic
1184448344 22:44567499-44567521 CAACATCCATGGACTCTGTAAGG + Intergenic
1184459211 22:44627736-44627758 GCACATGCATGGGCTCTGCGGGG - Intergenic
1184571914 22:45330644-45330666 CCACATTCACGGCCTCTACACGG + Exonic
950494202 3:13324067-13324089 CCACATCCCTGGGAGCTGCAGGG - Intronic
951095478 3:18624876-18624898 CCACATCCATGGGGCTTGCAAGG - Intergenic
952319138 3:32259477-32259499 TGACATTCATGGGCTCTTCAAGG + Intronic
953927044 3:46987889-46987911 CCACATCCCTGCGGTCTGCCGGG + Intronic
954817010 3:53290473-53290495 CCACAGCAATGGACTCTGCCAGG + Intronic
955059502 3:55483409-55483431 ACACATACATCGGCTCTGTAGGG + Intronic
955406916 3:58631401-58631423 CCTCTTCCATGGGCTCCACATGG + Intergenic
955631593 3:60981076-60981098 TCATAGCCAAGGGCTCTGCAAGG + Intronic
956275715 3:67498971-67498993 TCACATACATGGGTTCTGCAAGG + Intronic
956717092 3:72088205-72088227 CCACCTGCGAGGGCTCTGCAGGG + Intergenic
961141176 3:124557807-124557829 TCAGATCCAAGTGCTCTGCAAGG + Intronic
963997930 3:151732767-151732789 CCCTTTCCATTGGCTCTGCAAGG - Intergenic
964137550 3:153361955-153361977 CCACATCCATGTCCCCTGCATGG + Intergenic
965544711 3:169903696-169903718 CAACATCCGTGGGCTCTGCAAGG - Intergenic
967594881 3:191317089-191317111 CCACCCCCATGGGCTCTGCACGG - Intronic
968649740 4:1755781-1755803 GCCCATCCATGGGCACGGCATGG - Intergenic
969107801 4:4820990-4821012 CCCCATGCTTGAGCTCTGCATGG - Intergenic
969377294 4:6771374-6771396 CCACAGGCCTGAGCTCTGCAGGG + Intergenic
970142722 4:12999768-12999790 CCACATCACTGAGCTCTCCAGGG + Intergenic
970162104 4:13199284-13199306 TCATACCCATGGGTTCTGCAGGG - Intergenic
971749789 4:30632226-30632248 GCACTGCCGTGGGCTCTGCATGG + Intergenic
971959773 4:33471040-33471062 GCACTGCCATGGGCCCTGCATGG - Intergenic
975746760 4:77482453-77482475 CCACAAATCTGGGCTCTGCAAGG + Intergenic
978563701 4:110060075-110060097 CCACACCCATCTGCTCTCCAAGG - Intronic
979050253 4:115921228-115921250 CAACATACATGGGCTCCGCAAGG + Intergenic
979102541 4:116638775-116638797 ACACAGCCTAGGGCTCTGCAGGG + Intergenic
981217800 4:142191590-142191612 TTTCAACCATGGGCTCTGCAGGG - Intronic
981422961 4:144572235-144572257 TCTCATCCATGGGCTCTACAAGG + Intergenic
981499954 4:145439304-145439326 CCACAACTCTGGCCTCTGCAAGG + Intergenic
982934059 4:161448692-161448714 CCATAGCCATTGGCTATGCAGGG + Intronic
984878948 4:184393541-184393563 TCACATTCATGGGCGGTGCAAGG - Intronic
985433618 4:189905677-189905699 TCCCTTCCAGGGGCTCTGCAAGG + Intergenic
985629108 5:1005593-1005615 CCTCTTCCAGGGGCCCTGCAGGG - Intergenic
985670697 5:1205156-1205178 CCACGTCCAGGCGCCCTGCAGGG + Intronic
986037840 5:3958387-3958409 CCACATCCCAGGACTCTCCAGGG + Intergenic
988437846 5:31196160-31196182 CCACTTCCATCAGCTTTGCAAGG + Intronic
989012213 5:36885742-36885764 CGACATCCGTGGGCTCTGCAAGG + Intronic
990970670 5:61502405-61502427 CCAAACCTAGGGGCTCTGCAGGG - Intronic
991656074 5:68904981-68905003 CCACATCCATGTGCTGTTCCTGG - Intergenic
995215342 5:109588844-109588866 CGACATCCGTGGGCTCCACAAGG + Intergenic
995744595 5:115390566-115390588 TCTCATCCATGGGCTGGGCAGGG + Intergenic
998036913 5:138925311-138925333 TCTCATCCATGGGCTGGGCAGGG - Exonic
998512941 5:142728813-142728835 CCACAACTCTAGGCTCTGCAGGG - Intergenic
999670465 5:153955093-153955115 GCACTTCCTAGGGCTCTGCAAGG - Intergenic
1000320989 5:160134021-160134043 CCAGGACCATGGGCCCTGCACGG - Intergenic
1000742075 5:164981277-164981299 CCAAATCCATGGACTATGAAAGG - Intergenic
1001482115 5:172095711-172095733 CCACATCCTTGTGCTGTGGACGG - Intronic
1001705435 5:173737975-173737997 GCCCCTCCATGGGCTCTGGAGGG + Intergenic
1002814698 6:668940-668962 CCATATCCATGGGTTCTGCATGG - Intronic
1003610614 6:7611502-7611524 CCAGTGCCCTGGGCTCTGCATGG - Exonic
1003997127 6:11553155-11553177 TCACATACATGGGTTCTGCAGGG - Intronic
1004843458 6:19613270-19613292 CGACATCTATGGGCTCCACAAGG + Intergenic
1004982927 6:21046518-21046540 CCACAGCCATGAGCACTGCCTGG - Intronic
1005761219 6:28969861-28969883 CGACATCCATGGGTTCCGCAAGG - Intergenic
1005897720 6:30192117-30192139 CCACATACAGGGCCTCTGGAGGG + Intronic
1006921989 6:37633329-37633351 CCTCAGCCAGTGGCTCTGCAGGG + Exonic
1007519928 6:42444088-42444110 TCCCAGCCATGGGGTCTGCATGG - Intronic
1011242597 6:85288259-85288281 CGACATCCGTGAGCTCCGCAAGG + Intergenic
1012168770 6:95991602-95991624 CCACATTCATGGGCTCAGGAAGG + Intergenic
1012189303 6:96261021-96261043 CCCCTTCCATGGGCTCTGTGCGG - Intergenic
1012868510 6:104645859-104645881 CCACTGCCATGGGCTAGGCATGG - Intergenic
1014009247 6:116458048-116458070 CGACATCCATGGGGTCCACAAGG - Intergenic
1014600354 6:123403717-123403739 CCTCTTCCTTGTGCTCTGCAAGG - Intronic
1014945129 6:127488211-127488233 CCACTTCCATAGTCTCTTCAGGG + Intronic
1015512836 6:134056280-134056302 CCACATCAATGTGCACTGCAGGG - Intergenic
1016906588 6:149156893-149156915 CCATATTCATGGGCACTGCCTGG - Intergenic
1016906600 6:149156974-149156996 CCATATTCATGGGCACTGCCTGG - Intergenic
1017304202 6:152898163-152898185 CCAGATCCATGAGCTCAGCGTGG - Intergenic
1017945832 6:159095643-159095665 CAACACCCAAGGGCACTGCAAGG - Intergenic
1018173247 6:161158626-161158648 CAACGTCCAGGGTCTCTGCAAGG - Intronic
1018628455 6:165802683-165802705 CCACACATATGGGGTCTGCAAGG + Intronic
1018866317 6:167749107-167749129 CAACTTCCATGGGCACAGCAAGG + Intergenic
1019029821 6:169000496-169000518 CCACATGGCTGGGCCCTGCATGG - Intergenic
1019736583 7:2652878-2652900 CCAAGTCCATGGGCGCTGCTGGG - Intronic
1020444332 7:8253717-8253739 ATACATACATGGGTTCTGCAGGG + Intronic
1021056512 7:16054096-16054118 TCACACCACTGGGCTCTGCATGG - Intergenic
1021847498 7:24777326-24777348 CCACACCCATGGGCTGACCAAGG + Intergenic
1023676278 7:42633517-42633539 CCAAAACCATGGGCTCCGCTAGG + Intergenic
1024299485 7:47876373-47876395 CCAGAGCCCTGGGCCCTGCAGGG + Intronic
1028540898 7:91941087-91941109 CGTCCTCCATGGCCTCTGCAAGG - Exonic
1028898034 7:96063944-96063966 CGACATCCATGGGTCCTTCAAGG - Intronic
1029413850 7:100431009-100431031 CCCCTTCCATCTGCTCTGCAGGG + Exonic
1031009392 7:116509763-116509785 TCACCTCCTTGGGTTCTGCAGGG + Intergenic
1032398325 7:131606696-131606718 CCACATCAAAGGGCCTTGCAGGG - Intergenic
1034688701 7:152996806-152996828 CCAGATCCAGAGGCTCTGCTTGG - Intergenic
1035856834 8:2984770-2984792 CCAAACCCATGTGCTTTGCACGG - Intronic
1037491204 8:19398604-19398626 ACAAATGCATGGGCTATGCATGG + Intergenic
1037844889 8:22274549-22274571 AGACATCCAAGGGCTCTGCATGG - Intergenic
1038076574 8:24082199-24082221 CCTTACCTATGGGCTCTGCAGGG - Intergenic
1038416188 8:27397647-27397669 CCACCACCATGGGCTCTGCAGGG - Exonic
1039388683 8:37159421-37159443 TAACATCCATGTGCACTGCAAGG + Intergenic
1039445028 8:37624206-37624228 CCACAGCCGTGGGCTGAGCAGGG + Intergenic
1039866768 8:41511776-41511798 CAACATCCATGGGCTCTGCAAGG + Intergenic
1039939283 8:42075564-42075586 GCAGTTCCCTGGGCTCTGCATGG - Intergenic
1046013309 8:108576183-108576205 CAACATTCATGGACTTTGCATGG + Intergenic
1046357507 8:113107509-113107531 TCATTTCCATGGGTTCTGCAGGG - Intronic
1048914852 8:139172772-139172794 ATACATACATGGGTTCTGCAGGG - Intergenic
1049190102 8:141282570-141282592 CCGCATCCACGAGCTGTGCACGG - Intronic
1049280329 8:141740926-141740948 CCCCAGCCATGGGCTCTGGTGGG - Intergenic
1049441293 8:142610941-142610963 CTACACCCATGGGGTCTCCAGGG + Intergenic
1049586152 8:143433270-143433292 TTTCATCCATGGGCTCTGTAAGG + Intergenic
1049647709 8:143743078-143743100 CCACATCTACCAGCTCTGCAGGG + Intergenic
1052613002 9:30800191-30800213 CGACATCCATGGGCTCTGCAAGG - Intergenic
1053722733 9:40963795-40963817 TCCCTTCCAGGGGCTCTGCAAGG + Intergenic
1054343231 9:63888202-63888224 TCCCTTCCAGGGGCTCTGCAAGG - Intergenic
1055370207 9:75590398-75590420 CCACTTCCATTGGCTCTCCAGGG - Intergenic
1055708858 9:79037137-79037159 AGACATCCATGGGCTCCACAAGG - Intergenic
1055734552 9:79313116-79313138 CCACTTCCAGGAGCTGTGCAGGG - Intergenic
1056400405 9:86222290-86222312 CCACCTGCCGGGGCTCTGCAGGG - Intronic
1057203967 9:93159658-93159680 CCACGTGCCTGGGCTCAGCAGGG + Intergenic
1057549089 9:96039106-96039128 CCACATCTGTGGGCTCAGCTGGG - Intergenic
1059325463 9:113501582-113501604 CCGCTTCAATGGGCTCTGCAAGG + Intronic
1060348605 9:122838083-122838105 TGACATCCATGGGCTCCACAAGG + Intergenic
1061257427 9:129460718-129460740 CCACCTCCCTGGGGTCTGGAAGG + Intergenic
1061589696 9:131590428-131590450 CTGCCTCCCTGGGCTCTGCAAGG + Intronic
1061631240 9:131873619-131873641 CCATTTGCATGGGCTCTGAAGGG + Intronic
1061679761 9:132237225-132237247 CCACCTCCCTGGGCTCTTCGAGG + Intronic
1061841677 9:133362128-133362150 TCTCATCCATTGGCTCTGCAGGG - Exonic
1061937032 9:133863662-133863684 CCCCTTCCATGGGTTCAGCATGG + Intronic
1062034360 9:134376255-134376277 CCACAACCCTGGGCACTGCGAGG - Intronic
1203452432 Un_GL000219v1:132181-132203 TCCCTTCCAGGGGCTCTGCAAGG - Intergenic
1187641558 X:21296441-21296463 CCACACCCAGGGGATCTGAAAGG + Intergenic
1188728358 X:33613379-33613401 CCAGAAACATGGGCTCTGTAGGG - Intergenic
1193041096 X:77004613-77004635 CCACATCCATGGCCCATGCAGGG + Intergenic
1194254928 X:91623984-91624006 TGACATGCTTGGGCTCTGCAGGG + Intergenic
1194321983 X:92460203-92460225 CGACATCCATGGGCTCCGCAAGG + Intronic
1195968889 X:110453439-110453461 CAACAGCCATGGTCTCTGGAGGG + Exonic
1196674560 X:118405673-118405695 CCATATCCATGGGTTCCACATGG + Intronic
1197106283 X:122720404-122720426 CCAAGACAATGGGCTCTGCAGGG + Intergenic
1198437384 X:136630489-136630511 CCACATCACTGGGCTCTGGGGGG - Intergenic
1200085881 X:153604788-153604810 CAACATCCATGGGCTTTGCAAGG - Intergenic
1200573712 Y:4863587-4863609 TGACATGCTTGGGCTCTGCAGGG + Intergenic
1200630150 Y:5573680-5573702 CGACATCCATGGGCTCCGCAAGG + Intronic