ID: 923915028

View in Genome Browser
Species Human (GRCh38)
Location 1:238492311-238492333
Sequence TTGGAGAACCAGCCTGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 339}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923915019_923915028 26 Left 923915019 1:238492262-238492284 CCAGTCCTTGGAGATGGATCTGG 0: 1
1: 2
2: 20
3: 39
4: 202
Right 923915028 1:238492311-238492333 TTGGAGAACCAGCCTGAGGGAGG 0: 1
1: 0
2: 1
3: 22
4: 339
923915021_923915028 21 Left 923915021 1:238492267-238492289 CCTTGGAGATGGATCTGGACTCC 0: 1
1: 0
2: 14
3: 27
4: 245
Right 923915028 1:238492311-238492333 TTGGAGAACCAGCCTGAGGGAGG 0: 1
1: 0
2: 1
3: 22
4: 339
923915023_923915028 0 Left 923915023 1:238492288-238492310 CCATGAGAAATCTGAAGGCCAGC 0: 17
1: 12
2: 3
3: 24
4: 181
Right 923915028 1:238492311-238492333 TTGGAGAACCAGCCTGAGGGAGG 0: 1
1: 0
2: 1
3: 22
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923915028 Original CRISPR TTGGAGAACCAGCCTGAGGG AGG Intergenic
900343943 1:2202135-2202157 TTGGAGAACCAGGCTCCAGGAGG + Intronic
900411975 1:2516626-2516648 CTGGAGAAGCAGCCTCTGGGTGG + Intronic
900624549 1:3602287-3602309 TGGCAGACCCACCCTGAGGGTGG + Intronic
900763101 1:4486184-4486206 TTGGATGCGCAGCCTGAGGGAGG - Intergenic
901069169 1:6508715-6508737 GTGGAGAGCCTGCCTGAGGCTGG - Intronic
901139014 1:7016011-7016033 TTGGAGGAAGAGCCTGGGGGAGG - Intronic
901165252 1:7216260-7216282 TTGGAGGAAGAGCCTGGGGGAGG - Intronic
901808857 1:11754526-11754548 TCTGAGAACCGGCCTGAGGTGGG - Intronic
902093162 1:13920565-13920587 TTGGAGAATAAACCTGAGAGGGG + Intergenic
902381590 1:16055405-16055427 GTGGAGAGACAGCCAGAGGGAGG - Intronic
902405179 1:16178918-16178940 TTGAAGAAACAGGCTCAGGGAGG - Intergenic
904678999 1:32215835-32215857 CTGGAAAACCAGCCTGGGGCTGG + Exonic
905232357 1:36522142-36522164 CTGGAGACCCAGTCTGAGGGGGG - Intergenic
906506852 1:46386605-46386627 TTGGCTAGCCATCCTGAGGGGGG + Intergenic
907709045 1:56860863-56860885 TTGGAGAACTGGCCAGAGGCAGG + Intronic
908337898 1:63146149-63146171 TTGAGAAACCAGCCTAAGGGTGG - Intergenic
909891773 1:81016153-81016175 CTGGAGAACCAGCTTCATGGAGG - Intergenic
910771384 1:90835764-90835786 TAGGAGAAGGTGCCTGAGGGAGG + Intergenic
911763227 1:101640683-101640705 TTGGAGAACATACCTGAGGATGG + Intergenic
912851519 1:113129776-113129798 GTGGAGAATCAGCCTGAAAGGGG - Exonic
913481674 1:119294774-119294796 TTGGAGAACAGGCAGGAGGGTGG - Intergenic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
921009694 1:211129014-211129036 CTGGAGAACCATCAGGAGGGAGG + Intronic
921618090 1:217295734-217295756 TGGGAGAACCAGGTGGAGGGAGG - Intergenic
922074957 1:222234597-222234619 TTGGAGACCAGGCCTGAGGGTGG - Intergenic
923915028 1:238492311-238492333 TTGGAGAACCAGCCTGAGGGAGG + Intergenic
924473971 1:244367435-244367457 TGGGAGATCCAGCCTGGAGGGGG + Intronic
924802119 1:247335286-247335308 TTTGAGAAGCAGCCCCAGGGAGG + Intergenic
1063474646 10:6317773-6317795 TTGGAGACAGAGGCTGAGGGTGG + Intergenic
1063532074 10:6842856-6842878 TTGGAGAATAAACCTGAGAGGGG - Intergenic
1064623404 10:17238357-17238379 TTGGTGAACTAGGCTGAGTGTGG - Intergenic
1065123872 10:22554530-22554552 GTGCAGAAACAGCCAGAGGGTGG + Intronic
1065456927 10:25916562-25916584 TTGGAGAATAAACCTGAGAGGGG - Intergenic
1066227542 10:33398467-33398489 TTTTAGAACCAGTCAGAGGGTGG - Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067326607 10:45274576-45274598 TTGGAGAATAAACCTGAGAGGGG + Intergenic
1068268392 10:54685236-54685258 TTGAAGAACCTGTCTGAGGGTGG + Intronic
1068366155 10:56052769-56052791 TTGGAGAATAAACCTGAGCGGGG + Intergenic
1069528407 10:69195221-69195243 TTAGAGATCCAGCCAGAGGATGG + Exonic
1069630354 10:69893821-69893843 CTGAAGAGCCAGCCTCAGGGTGG + Intronic
1070630919 10:78084064-78084086 CTGGGGAACCAGGATGAGGGTGG + Intergenic
1071220756 10:83462481-83462503 TTGTAGAACCACCTTGAGGAAGG + Intergenic
1071667747 10:87577038-87577060 TTTGACACCCTGCCTGAGGGTGG + Intergenic
1071724155 10:88179177-88179199 TGGGAGTACCAGATTGAGGGTGG + Intergenic
1072315246 10:94196358-94196380 TGTGACAACCAGGCTGAGGGTGG - Intronic
1075007067 10:118838954-118838976 TTGGAGAAGGAGCCTTTGGGTGG - Intergenic
1075680212 10:124326056-124326078 CTCAAGAGCCAGCCTGAGGGGGG - Intergenic
1075714381 10:124547687-124547709 CAGGAGAAGCAGTCTGAGGGAGG + Intronic
1077331256 11:1984701-1984723 GAGGAAAACCAGCCTGTGGGGGG + Intergenic
1078563493 11:12393628-12393650 TTGGGGGACCAGCCTGAATGTGG + Intronic
1078940718 11:16002118-16002140 TTTCAGGACCAGCCTGATGGAGG + Intronic
1079339429 11:19599777-19599799 TTTGAGAAACAGCATGAGGGAGG + Intronic
1079349813 11:19682967-19682989 TTGCAGAACTAGGATGAGGGAGG + Intronic
1082221699 11:49646786-49646808 TTGGAGAATAAACCTGAGAGGGG + Intergenic
1084004608 11:66316369-66316391 TGCGTGAAGCAGCCTGAGGGAGG - Exonic
1084779648 11:71399895-71399917 TTAGATGACCAGCCTGAGGCAGG + Intergenic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1086627330 11:88972373-88972395 TTGGAGAATAAACCTGAGAGGGG - Intronic
1088019797 11:105105480-105105502 TTGGATTACCAGCTTCAGGGTGG - Intergenic
1088265201 11:107981913-107981935 TTGGCTAGCCATCCTGAGGGTGG + Intergenic
1089271629 11:117305525-117305547 TTGAAAAACCAGCCAGAGGTGGG - Intronic
1089713008 11:120330452-120330474 TTGGAGAAGCAGGCGGAGTGAGG + Exonic
1090568205 11:128018959-128018981 TTGGAGAAAGAGCCTGAGCATGG - Intergenic
1090621417 11:128564204-128564226 TTGCTGATCAAGCCTGAGGGTGG + Intronic
1090815405 11:130289694-130289716 TAGGAGAGCCAGCCTAAGGATGG + Intronic
1202814237 11_KI270721v1_random:39877-39899 GAGGAAAACCAGCCTGTGGGGGG + Intergenic
1091929183 12:4381106-4381128 TTGGAGAAGCAGCCTAGGGAAGG - Intergenic
1092509459 12:9139817-9139839 TTGGAGAATAAACCTGAGAGGGG + Intergenic
1092509993 12:9144583-9144605 TTGGAGAATAAACCTGAGAGGGG + Intergenic
1093427163 12:19041050-19041072 TTGGAGAACAAAGCTGAGGAAGG + Intergenic
1093787257 12:23207113-23207135 TCAGGGAACCAGCCTGACGGAGG + Intergenic
1094490882 12:30959950-30959972 TTGGGGGATCAGCCTGTGGGCGG + Intronic
1094601130 12:31909746-31909768 TTGGAGAATAAACCTGAGAGGGG - Intergenic
1097448556 12:59707364-59707386 TTTTAGATCCAGCCAGAGGGTGG - Intronic
1097733470 12:63154699-63154721 TTGGAGAATAAACCTGAGAGGGG - Intergenic
1099090761 12:78304983-78305005 TTGGATAACAAACCTGAGAGGGG + Intergenic
1101932877 12:109029280-109029302 TTGGAGAATAAACCTGAGAGGGG + Intronic
1103993132 12:124812415-124812437 TTGGGGATCCAGGCTGAGGGAGG - Intronic
1105543002 13:21330995-21331017 CTGGGGAACCAGCCTGAGACAGG - Intergenic
1106232062 13:27828117-27828139 TTGGAGAATTAGGCAGAGGGCGG - Intergenic
1106409891 13:29504315-29504337 TTGTAGAACCAAACTGAAGGGGG - Exonic
1107477693 13:40755499-40755521 CTGGGGAAACAGCCTGATGGAGG + Intronic
1107624620 13:42270662-42270684 TTGGAGAATAAACCTGAGAGGGG - Intergenic
1107907221 13:45072390-45072412 TTGGAGATGGAGCCTGTGGGAGG - Intergenic
1108830597 13:54473188-54473210 CTTGAGAAGCAGCCTGAGGTTGG + Intergenic
1111065348 13:83083890-83083912 TTGGAGAATAAACCTGAGAGGGG - Intergenic
1113627637 13:111858324-111858346 TTGGAGAAGCAGCCTTTGCGGGG + Intergenic
1113898906 13:113784948-113784970 TTGGAGAATAAACCTGAGAGGGG + Intronic
1115532835 14:34342903-34342925 TTGGAGAATAAACCTGAGAGGGG + Intronic
1116001094 14:39243573-39243595 ATGAAGAACCAGGCTGGGGGTGG + Intronic
1117313083 14:54547884-54547906 TTAAAGAACCAGGCTGAGGAAGG - Intergenic
1117861682 14:60098351-60098373 TTGGAGAATAAACCTGAGAGAGG - Intronic
1118961392 14:70536973-70536995 TTGGAGAATAAACCTGAGAGGGG - Intergenic
1118962218 14:70544250-70544272 TTGGAGAATAAACCTGAGAGGGG - Intergenic
1119370730 14:74139548-74139570 TTGGAGAAATAGCCAAAGGGAGG - Intronic
1120917338 14:89721577-89721599 ATGGAAAGCCAGTCTGAGGGGGG + Intergenic
1121290026 14:92766587-92766609 AATGAGAACCAGCCTGAGAGGGG + Intergenic
1121410248 14:93744451-93744473 CTGGAGAGCCAGCCTGGGTGCGG + Intronic
1124199206 15:27662746-27662768 TTGAAGAATCAACCTGAGAGGGG + Intergenic
1125408099 15:39374584-39374606 TTGAGGAACCAGCCTGACAGAGG - Intergenic
1125538503 15:40456552-40456574 TCAGAAAACCAGGCTGAGGGTGG - Intronic
1125791387 15:42369003-42369025 TTGGAGAATAAACCTGAGAGGGG + Intronic
1127628089 15:60800080-60800102 TTGGGCAACCAACGTGAGGGTGG - Intronic
1127705339 15:61541360-61541382 TTAGAGACCCAGACTGAAGGAGG + Intergenic
1128199981 15:65796561-65796583 TTGGGGAACGGGGCTGAGGGTGG + Intronic
1131182365 15:90249484-90249506 TTGGAGAAGCGTCCTGGGGGCGG - Intergenic
1131308267 15:91265057-91265079 TTAGAGAGCCAGCCTGTGGTTGG + Intronic
1132153339 15:99477609-99477631 TTGAAGAAACAGGCTCAGGGAGG + Intergenic
1134877659 16:17716329-17716351 TTGGAGAATAAACCTGAGAGGGG - Intergenic
1135227061 16:20670117-20670139 TTTGAGACCTGGCCTGAGGGTGG - Intronic
1135810686 16:25584118-25584140 TTGGAGAATAAACCTGAGAGGGG - Intergenic
1141153667 16:81582174-81582196 TTGGAGAAGGGGCCTGTGGGAGG - Intronic
1141820694 16:86443367-86443389 TTGGAGGACCAGCCAGGGAGAGG + Intergenic
1142098083 16:88255697-88255719 TTGGAGAATAAACCTGAGAGGGG + Intergenic
1142326125 16:89415853-89415875 ATGGAGAACCAGCCTCAGTGAGG + Intronic
1142921341 17:3189824-3189846 TTGGAAAATAAACCTGAGGGGGG + Intergenic
1144839897 17:18179420-18179442 CCGGAAAACAAGCCTGAGGGAGG + Exonic
1146742377 17:35297987-35298009 TTGGAGAATAAACCTGAGAGGGG - Intergenic
1146794697 17:35773110-35773132 TTGGAGAAGCAGTTTGGGGGTGG - Intronic
1147552204 17:41451469-41451491 TTGGAGAATAAACCTGAGAGAGG - Intergenic
1147760676 17:42795707-42795729 TTGGAGAACCAGAGAGAGTGGGG - Exonic
1148632474 17:49121929-49121951 TTGGAGAATAAACCTGAGAGGGG + Intergenic
1148633442 17:49129585-49129607 TTGGAGAATAAACCTGAGAGGGG + Intergenic
1149011489 17:51861316-51861338 TTGCAGAACCAGCCTCATTGTGG + Intronic
1149200692 17:54182759-54182781 GTGGAGACCCAGCCTTAAGGTGG - Intergenic
1149258986 17:54858637-54858659 CTGGGGAACCAGCCTGAAGGTGG + Intergenic
1149347178 17:55750935-55750957 CTGGAGGAGCGGCCTGAGGGTGG - Intergenic
1149550487 17:57535743-57535765 TTGGGGATCCAGCCAGAGGGAGG + Intronic
1149800020 17:59558441-59558463 TTAGAGAATAAGCCTGAGAGGGG - Intergenic
1150220706 17:63494314-63494336 GGGGAGAACCAGGCTGGGGGTGG - Intronic
1150632307 17:66888627-66888649 TTGGAGAATAAACCTGAGAGGGG + Intergenic
1151242232 17:72767114-72767136 TTGGAGAATAAACCTGAGAGGGG - Intronic
1152133581 17:78491558-78491580 GTGGAGAACAGGCCTGGGGGAGG + Exonic
1152300957 17:79495240-79495262 TTGGAGAAGCCTCCTGAAGGGGG + Intronic
1152877319 17:82794239-82794261 TTGGAGAACATGCCCCAGGGGGG + Intronic
1152914454 17:83026203-83026225 CTGGAGAACCAGCGAGAGCGTGG + Intronic
1153250370 18:3115857-3115879 TGTGAGAACCGGCCTGAGGGAGG + Intronic
1153851180 18:9096136-9096158 TTTAAGAAGCAGCCTGAGGGAGG + Intergenic
1154089451 18:11343894-11343916 TTGGAGAATAAACCTGAGAGGGG - Intergenic
1155464327 18:26119296-26119318 TTGGAGAATAAACCTGAGAGGGG + Intergenic
1156731405 18:40197660-40197682 TTGGAGAATAAACCTGAGAGGGG + Intergenic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1158863901 18:61619160-61619182 TTGGAGAATAAACCTGAGAGAGG - Intergenic
1159208235 18:65281590-65281612 TTGGAGAATAAACCTGAGGGGGG - Intergenic
1160627916 18:80225556-80225578 TGTGAAAACCAGCCTGAAGGGGG - Intronic
1161827550 19:6578877-6578899 TTGGAGAATAAACCTGAGAGGGG + Intergenic
1162934577 19:13975273-13975295 CAGGAGAACCACCCTGAAGGTGG + Intronic
1162971500 19:14183685-14183707 CTGGACCACCAGCCTGGGGGAGG + Exonic
1163073532 19:14866727-14866749 TTGGAGAACAAACCTGAGAGGGG - Intergenic
1164458608 19:28429076-28429098 TATGGGAACCAGCGTGAGGGAGG + Intergenic
1165869156 19:38958482-38958504 TTGGAGAATAAGCCTGAGAGGGG + Intronic
1166763675 19:45239857-45239879 GTGGAGAAACAGGCTGAGAGGGG + Intronic
1167277839 19:48549750-48549772 TTGGTGGACGAGCCTGGGGGAGG + Intergenic
1167451711 19:49574226-49574248 TTGACAAACCAGCCTCAGGGGGG + Intronic
1168207884 19:54865681-54865703 TAGGACAAGCAGCCTGATGGCGG - Intronic
1168518115 19:57025690-57025712 TTGGAGAATAAACCTGAGAGGGG + Intergenic
925257983 2:2506365-2506387 TTGGAGAATAAACCTGAGAGGGG + Intergenic
925475156 2:4205314-4205336 TTGGAGAATAAACCTGAGAGGGG - Intergenic
926113841 2:10198702-10198724 TTGGAGAATAAACCTGAGAGGGG + Intronic
926548315 2:14270035-14270057 TTGGAGAATAAACCTGAGAGGGG + Intergenic
929589042 2:43133444-43133466 TGGGTGGACCAGCCTGAGGCTGG + Intergenic
931849998 2:66243489-66243511 TTGGAGAACCAGGCTCTGAGAGG - Intergenic
931850941 2:66249857-66249879 TTGGAGAACCAGGCTCTGAGAGG - Intergenic
932226347 2:70044079-70044101 TCTGAGAACCAGACTGAGGAAGG - Intergenic
932743023 2:74306468-74306490 TTGGAGAATAAACCTGAGAGGGG - Intronic
932743097 2:74307039-74307061 CTTGGGAAACAGCCTGAGGGAGG - Intronic
934521530 2:95023075-95023097 TTGCAGAGCCAGCCTGGGGAAGG - Intergenic
934607789 2:95710663-95710685 TTGGAAAGCCAGCCAAAGGGAGG + Intergenic
934819152 2:97356966-97356988 TTGGAGAATAAGCCTGAGAGGGG - Intergenic
936056730 2:109267598-109267620 TGGGTGGACCAGGCTGAGGGAGG + Intronic
936541135 2:113352543-113352565 TTGGAAAGCCAGCCAAAGGGAGG + Intergenic
936707379 2:115090656-115090678 TTGGAGAACAAACCTGAGAGGGG + Intronic
936786651 2:116101380-116101402 TTGGAGAAAAAGCTTGAGGTAGG - Intergenic
937341791 2:121095936-121095958 CTGGGGAACCAGTCTGAGGCCGG + Intergenic
939904218 2:147890869-147890891 TTGCAGAATCAGCTTGAGGAGGG + Intronic
941269315 2:163405672-163405694 TTGGAGAGCCAGGCTAATGGAGG - Intergenic
941617508 2:167737638-167737660 TTGGAGAACTGCCCTGAAGGAGG + Intergenic
942740079 2:179166278-179166300 TTGGAGCACAAGCCTGGGTGAGG + Intronic
942894208 2:181032014-181032036 ATGGAAAACCAGCTTCAGGGAGG + Intronic
945742695 2:213682486-213682508 TTGGAGAATAAACCTGAGAGGGG + Intronic
946547577 2:220761491-220761513 TTGTAGAACAAGGCTGATGGTGG + Intergenic
947463494 2:230322702-230322724 TTGGAGAATAAACCTGAGAGGGG - Intergenic
947846719 2:233250783-233250805 TTGGAGAATAAACCTGAGAGGGG + Intronic
948113948 2:235479813-235479835 CTGCAGAACCAGCATGGGGGTGG - Intergenic
948160042 2:235815906-235815928 TTTCAAAACCAGCCTGAAGGAGG - Intronic
948227416 2:236322159-236322181 TTGGAGAATAAACCTGAGAGGGG - Intergenic
948260540 2:236601220-236601242 TGGGAGAACCAGGCAGAGGCTGG - Intergenic
948394241 2:237632655-237632677 TTGGAGAACCAAGCTGGGGATGG + Intronic
948537719 2:238658555-238658577 TTGGAGAACCATCCTAGGAGAGG - Intergenic
1169937889 20:10904446-10904468 TTAGAGAACCAGGCTCAGAGAGG + Intergenic
1170207550 20:13814869-13814891 TTGCAGAAGCAGTGTGAGGGTGG - Intronic
1170464048 20:16606807-16606829 TCAGAGATCCAGACTGAGGGAGG + Intergenic
1170662883 20:18360092-18360114 CTGGAGGACAAGCCTGAGGCTGG - Intergenic
1173331371 20:42078722-42078744 TGGGAGAAGCAGTCTGGGGGAGG - Exonic
1174651361 20:52128610-52128632 TTGGAAAACTGACCTGAGGGAGG + Intronic
1177336652 21:19736894-19736916 TTGGAGAATAAACCTGAGAGGGG + Intergenic
1177953271 21:27565851-27565873 CTGGAGAACCAAGCTGAGGCTGG - Intergenic
1178160859 21:29912493-29912515 TTGGAGAATAAACCTGAGAGGGG - Intronic
1178299190 21:31437593-31437615 TTGGAGAAAGGGCCTGTGGGAGG + Intronic
1178342033 21:31793892-31793914 TTGGAGAATTAGCCACAGGGAGG - Intergenic
1178582964 21:33851277-33851299 ATGGAGACCCAGCCTCAGGAGGG + Intronic
1179579240 21:42329686-42329708 TTGGAGAATAAACCTGAGAGGGG - Intergenic
1179624145 21:42638747-42638769 TTGGAGAGCCAGCCAGCCGGGGG - Intergenic
1181787654 22:25238447-25238469 TTGGAGATACAGCGGGAGGGAGG + Intergenic
1181819390 22:25463485-25463507 TTGGAGATACAGCGGGAGGGAGG + Intergenic
1182891091 22:33819480-33819502 TTGGTGAAACAGCCTGTGGATGG - Intronic
1183090748 22:35520246-35520268 TTGCAAAACCTGCCTGGGGGAGG - Intergenic
1183602399 22:38847553-38847575 TTGGAGAAGCACCTGGAGGGAGG - Intergenic
1184037587 22:41926064-41926086 TAGGGGAACCAGTCTGAGCGGGG - Intronic
1184096740 22:42320169-42320191 TTTGAGAAACAGCCAGAAGGCGG - Intronic
1184296366 22:43527774-43527796 TTGGAGAACCTTCCAGAAGGTGG + Intergenic
1184682769 22:46080734-46080756 TTGGAGAACCAATTAGAGGGAGG - Intronic
1185107495 22:48882696-48882718 CTGCAGACCCAGCCTGGGGGAGG + Intergenic
950008650 3:9706772-9706794 TTGGAGCAACAACCTGAGGGAGG + Intronic
950152766 3:10700822-10700844 TCAGAGAACCAGACTGAGGGAGG + Intronic
951059035 3:18183117-18183139 TTGGAGTCCCAGATTGAGGGTGG - Intronic
951198945 3:19855809-19855831 TTGGAGTACCAGGCTGTGTGAGG - Intergenic
951666132 3:25125932-25125954 CAGGAAAACCAGACTGAGGGTGG + Intergenic
953678381 3:45021073-45021095 ATGGAGAACCACGCTGAGGAGGG - Intronic
954761246 3:52875923-52875945 CTGGAGAAGCAGTGTGAGGGTGG + Intronic
957117960 3:76050599-76050621 CACGAGAACCAGCCTGTGGGTGG - Intronic
957501647 3:81066137-81066159 TTGGAGAATAAACCTGAGAGGGG - Intergenic
957983583 3:87543774-87543796 TTGGAGAATAAACCTGAGAGGGG - Intergenic
958269199 3:91477634-91477656 TTGGAGAATAAACCTGAGTGGGG - Intergenic
960275819 3:115728105-115728127 ATGGAGAGACAGCATGAGGGAGG + Intergenic
960965682 3:123103129-123103151 CTGGGCATCCAGCCTGAGGGTGG - Intronic
965404047 3:168249173-168249195 TTAGAGCACTAGGCTGAGGGAGG - Intergenic
967273244 3:187748208-187748230 TAGTAGAACCAGCCAGAGTGGGG + Intergenic
967823845 3:193862952-193862974 TTGGAGTCCCAGACTGAGGCAGG - Intergenic
968521987 4:1038210-1038232 TTGTAGGACCAGCCCGGGGGTGG - Intergenic
968573678 4:1355210-1355232 CTGGACATCGAGCCTGAGGGAGG + Exonic
968978227 4:3833002-3833024 TTTCAGAACCAGCCTGTGGGTGG + Intergenic
968992717 4:3925427-3925449 GTGGATGACCATCCTGAGGGAGG + Intergenic
969268871 4:6085377-6085399 GTGGGGGACCAGCCTGAGGCTGG + Intronic
969600180 4:8171491-8171513 TGGGGGAACCAGCTTGAGGCAGG + Intergenic
969829809 4:9786159-9786181 ATGGAGACCCAGCCTGAGCTGGG + Intronic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
972298796 4:37765847-37765869 TTGGAAAGACAGTCTGAGGGTGG + Intergenic
976268611 4:83208078-83208100 TTGGAGAATAAACCTGAGAGAGG - Intergenic
976671810 4:87662298-87662320 GTGGACAGCAAGCCTGAGGGAGG + Exonic
979889823 4:126077313-126077335 TGGGAGAAGCAACCTGATGGAGG + Intergenic
980105542 4:128584848-128584870 TTGGAGAATTAGACTGAGGATGG + Intergenic
982099232 4:151952262-151952284 GGGGAGAACCAGCCTGTGTGTGG + Intergenic
982184367 4:152780560-152780582 TTGGACAGCAAGCCTGAAGGTGG - Intronic
982528931 4:156513809-156513831 TTGGAGATCCAGGCTGAGAAAGG + Intergenic
982792464 4:159609270-159609292 TTGGAGAATAAACCTGAGAGGGG + Intergenic
983366935 4:166803308-166803330 TTTGAGGACCAGCCTAAGGATGG + Intronic
984985389 4:185324372-185324394 TTGGAGAATAAACCTGAGAGGGG + Intronic
984986018 4:185330078-185330100 TTGGAGAATAAACCTGAGAGGGG + Intronic
985123744 4:186669670-186669692 GTGGAGAACGAGACTGAAGGGGG + Intronic
986210529 5:5667426-5667448 ATGGAGACCCAGCCTTGGGGAGG + Intergenic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987788872 5:22537761-22537783 TTGGAGAATAAACCTGAGAGGGG - Intronic
988330366 5:29830303-29830325 ATGGAGAAACAGCCAGATGGTGG + Intergenic
992295692 5:75324359-75324381 ATGGAGTGCCAGCCTGAGGGTGG - Intergenic
992309510 5:75481265-75481287 TTTGAGAAGCAGTCTGAAGGTGG - Intronic
993852153 5:93023756-93023778 GAGGAGAAACAGCCTAAGGGAGG + Intergenic
994817180 5:104598636-104598658 TTGGAAAATAAGCCTGAGAGGGG - Intergenic
994903266 5:105803472-105803494 TTGGAGAATAAACCTGAGAGGGG + Intergenic
994930231 5:106173244-106173266 TTGGAGAACAAACATGAGAGGGG - Intergenic
995681283 5:114723007-114723029 TTGGAGAATTAACCTGAGAGGGG - Intergenic
995681579 5:114726502-114726524 TTGGAGAATAAACCTGAGAGGGG - Intergenic
996511934 5:124326323-124326345 AAGGAGAGCCAGCCTTAGGGGGG - Intergenic
999730445 5:154473345-154473367 ATGGAGAAACAGACTCAGGGAGG - Intergenic
1000555271 5:162718148-162718170 TTGGAGAATAAACCTGAGAGGGG - Intergenic
1000592726 5:163177935-163177957 TTGGAGAAGCAGTTTGTGGGAGG + Intergenic
1002079825 5:176730898-176730920 TTAGGGAACCAGGCTGATGGAGG - Intergenic
1002522232 5:179798265-179798287 TTGTAGAAGGAGCCTGTGGGAGG + Exonic
1002566330 5:180114351-180114373 TTGGACACCCAGCCTCATGGGGG - Intronic
1002787749 6:417332-417354 TTGGAGACCCAAACAGAGGGTGG - Intergenic
1002974938 6:2065170-2065192 TTGGAGTACCAGGCTGTGTGAGG - Intronic
1003004697 6:2369916-2369938 TTGGAGCCCCAGTCTGAGAGTGG - Intergenic
1003168043 6:3698409-3698431 TTGGAGAATAAACCTGAGAGGGG - Intergenic
1004356438 6:14933507-14933529 GGGGAGAACAAGGCTGAGGGTGG + Intergenic
1006452169 6:34111630-34111652 TGGGAGAACCAGCCTGGCAGGGG + Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1007720835 6:43884654-43884676 ATGGAGAGCCAGCCTCGGGGTGG + Intergenic
1007994843 6:46295834-46295856 TTGGGGAAGCAGCAGGAGGGAGG + Intronic
1008157501 6:48034532-48034554 TTATAGAACAAGGCTGAGGGTGG + Intronic
1008262823 6:49387641-49387663 TTGGAGTACCAGGCTGTGTGAGG - Intergenic
1008986027 6:57544106-57544128 TTGGAGAATAAACCTGAGTGGGG + Intronic
1009173986 6:60436657-60436679 TTGGAGAATAAACCTGAGTGGGG + Intergenic
1009754882 6:67924280-67924302 TTTGAGAAACAACCTGAGGTGGG + Intergenic
1010505068 6:76646998-76647020 TACCAGAAGCAGCCTGAGGGAGG - Intergenic
1010823658 6:80446687-80446709 TTGGAGAATAAACCTGAGAGGGG + Intergenic
1011630602 6:89320271-89320293 TTGGAGAATAAACCTGAGAGGGG - Intergenic
1016034929 6:139374981-139375003 GGGTAGATCCAGCCTGAGGGGGG - Intergenic
1016174328 6:141060208-141060230 TTTGAGAACCTGGCTGAGGTAGG - Intergenic
1016543620 6:145195466-145195488 TTGGAGGAAGGGCCTGAGGGAGG - Intergenic
1017809465 6:157974556-157974578 TGGGAGAACAAGGCTGATGGTGG - Intergenic
1019048829 6:169167932-169167954 CCTGAGAACCAGCCTGAGGCTGG - Intergenic
1019144563 6:169968395-169968417 TTGGAGAATAAACCTGAGAGGGG + Intergenic
1019311963 7:367237-367259 TTGGAGAACCTGGCTGGGTGAGG - Intergenic
1019550415 7:1599529-1599551 TTGGAGAACCAGACTTGGTGGGG + Intergenic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1020356484 7:7281038-7281060 TTGGAGAATAAACCTGAGAGGGG - Intergenic
1020956213 7:14742236-14742258 TTGGATAATTGGCCTGAGGGTGG - Intronic
1021828140 7:24574034-24574056 ATGGAGAGCCGGCCTGGGGGCGG + Intronic
1022625883 7:32035398-32035420 TTGGAGAATAAACCTGAGAGGGG - Intronic
1023156523 7:37257226-37257248 TTGGAGTTCCATCATGAGGGAGG - Intronic
1023889413 7:44381757-44381779 CTCGTGAACCTGCCTGAGGGTGG + Exonic
1024876912 7:54036616-54036638 TTGGAGAATAAACCTGAGAGGGG - Intergenic
1024913207 7:54469873-54469895 TTGGAGAAGCAGCCAGAGCCAGG + Intergenic
1027545801 7:79526006-79526028 CTGAAGAACCAGCCTGTGGCTGG + Intergenic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1029821255 7:103149553-103149575 CTGGAGAGGCAGCCTGAAGGAGG - Intronic
1031013570 7:116548755-116548777 TAGGAGACCGAGCCTCAGGGAGG - Intronic
1031773693 7:125879426-125879448 TTGGAGAATAAACCTGAGAGGGG - Intergenic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1034051643 7:147990323-147990345 TTGGAGAACAAACCTAAGAGGGG + Intronic
1034069901 7:148174424-148174446 CTGAAGCACCAGCCTGAGGTGGG - Intronic
1035568407 8:657214-657236 TTGGAGAATAAACCTGAGAGGGG + Intronic
1035770237 8:2141487-2141509 TTGGAGAATAAACCTGAGTGGGG + Intronic
1036110791 8:5899709-5899731 GTGGAGACCCAGCGTGAAGGAGG - Intergenic
1036283873 8:7426244-7426266 TTTTAAAAGCAGCCTGAGGGCGG - Intergenic
1036337602 8:7885286-7885308 TTTTAAAAGCAGCCTGAGGGCGG + Intergenic
1037142256 8:15533663-15533685 TTGGAGAAAAAACCTGAGAGGGG + Intronic
1038324927 8:26565876-26565898 TTGGAGAAAAAGCCTGGAGGAGG + Intronic
1039659549 8:39447783-39447805 TTGGAGAATGAACCTGAGAGAGG - Intergenic
1040853341 8:51924304-51924326 TTGGAGAATAAACCTGAGAGGGG - Intergenic
1041318337 8:56587621-56587643 TTGGAGAACCAACATGAGAAAGG + Intergenic
1041882110 8:62763795-62763817 TTGGAGAATAAACCTGAGAGGGG + Intronic
1042811908 8:72834950-72834972 TTGGAAAACCAGCAGGAGGAAGG + Intronic
1046268732 8:111865118-111865140 TTGGAGAATTAGCATGAGAGGGG - Intergenic
1046843896 8:118893216-118893238 TTGGAGTACCAGCCTTAAGTCGG - Intergenic
1047019563 8:120760525-120760547 CTGGAGACCCAGCCTGAGAGAGG + Intronic
1047350828 8:124071972-124071994 TTGGAGACACAGCTTTAGGGAGG - Intronic
1048220024 8:132532602-132532624 TTGGAGAGGCTGCCTGAGGCTGG - Intergenic
1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG + Intergenic
1049500538 8:142961021-142961043 TTGGATTACCAGCTTTAGGGTGG - Intergenic
1051895248 9:21979788-21979810 CTGGAGAACCCAGCTGAGGGTGG + Intronic
1052736172 9:32344796-32344818 GTGGAGAGGCAGCCTGTGGGAGG - Intergenic
1053613657 9:39741891-39741913 TTGGAGAATAAACCTGAGAGGGG + Intergenic
1053640226 9:40067498-40067520 TAGGTGAACCAGCCTCAGGCAGG + Intergenic
1053871698 9:42499847-42499869 TTGGAGAATAAACCTGAGAGGGG + Intergenic
1054239857 9:62600506-62600528 TTGGAGAATAAACCTGAGAGGGG - Intergenic
1054320923 9:63663502-63663524 TAGGTGAACCAGCCTCAGGCAGG + Intergenic
1054544521 9:66309136-66309158 TAGGTGAACCAGCCTCAGGCAGG - Intergenic
1054553990 9:66635033-66635055 TTGGAGAATAAACCTGAGAGGGG - Intergenic
1054854421 9:69883194-69883216 TTGGAGAATAAACCTGAGAGGGG + Intronic
1055907313 9:81309602-81309624 TTGGAATACAAGCCTGAGGCTGG - Intergenic
1056162038 9:83906387-83906409 CTGGAGAACCTGCCAGAGGAGGG - Intronic
1056590075 9:87959836-87959858 TTGGAGAATGAACCTGAGAGGGG + Intergenic
1060309590 9:122447340-122447362 TTGGAGAATAAACCTGAGAGGGG - Intergenic
1060341979 9:122785604-122785626 TTGGAGAAGGAGCCTTTGGGAGG + Intergenic
1061319174 9:129817018-129817040 GTGGAAAGCCAGCCTGATGGAGG - Intronic
1061431214 9:130532591-130532613 TTAGAAACCCAGCCTGAGGCTGG - Intergenic
1061779910 9:132989335-132989357 TTGGAGACCCAGACCCAGGGAGG - Intronic
1185620143 X:1449187-1449209 TTGGAGAACAAGCCTGAGCGGGG - Intronic
1186202552 X:7169061-7169083 TTGTAGAACCAGACAGATGGTGG - Intergenic
1188670628 X:32877850-32877872 CTGCAGAACCAGACTGAGGCTGG + Intronic
1190255593 X:48760104-48760126 TTTGAAAAACAGGCTGAGGGTGG - Intergenic
1192080246 X:68040809-68040831 ATGGAGAAACATACTGAGGGGGG - Intergenic
1194909554 X:99624163-99624185 TTAGAAAACCTGCATGAGGGTGG - Intergenic
1195003767 X:100667155-100667177 TGGGAGAAACAGCCAGAGAGAGG + Intronic
1195862295 X:109395195-109395217 TTGGAGGAACAGCCTGGGAGTGG - Intronic
1198444589 X:136699747-136699769 CTGGAGAACCATCTTGAGGCGGG + Intronic
1199499448 X:148493946-148493968 TGGAAGAAAGAGCCTGAGGGGGG + Intergenic
1200052096 X:153438978-153439000 ATGGAAGACCAGGCTGAGGGAGG - Intergenic
1200242998 X:154507541-154507563 TTGGAGAACGGGCTTGTGGGAGG - Intronic
1201237371 Y:11924073-11924095 TTGGAGCACCAGCCTTGGTGTGG + Intergenic
1201353255 Y:13069520-13069542 TTGGAGAATAAACCTGAGGGGGG - Intergenic
1201574886 Y:15452350-15452372 TGGGAGGGCCAGCCAGAGGGTGG - Intergenic